معلومة

13.6: إنتغرينز - علم الأحياء

13.6: إنتغرينز - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

تم إدخال الإنتغرينات حتى الآن كمستقبلات للفيبرونيكتين واللامينين ، لكنها عائلة كبيرة بها مجموعة متنوعة من الركائز. على سبيل المثال ، يُظهر الالتصاق البؤري (الشكل ( PageIndex {8} )) مستقبلات إنتجرين مرتبطة بالكولاجين. كما تمت مناقشته سابقًا في الفصل السابق ، عادةً ما تكون الالتصاقات البؤرية عابرة ، ويُنظر إليها على أنها نقاط اتصال مثل الخلايا الليفية أو الخلايا المهاجرة الأخرى التي تزحف على طبق ثقافة أو شريحة مغطاة ببروتينات ECM.

بالإضافة إلى الكولاجين ، تعتبر الفبرونيكتين واللامينين أيضًا شريكًا محتملًا لربط الإنتجرينات. كما يوضح الجدول 1 ، فإن تنوع الوحدات الفرعية والتركيبات يعني أن الإنتجرينات تشارك في مجموعة واسعة من العمليات الخلوية ، ويمكنها ربط بروتينات سطح الخلية وكذلك ECM.

الجدول 1: مستقبلات إنتغرين ، روابطها وتوزيعها.
الوحدات الفرعيةيجندتوزيع
α1β1في الغالب الكولاجين ، وكذلك اللامينينواسع الانتشار
α2β1في الغالب الكولاجين ، وكذلك اللامينينواسع الانتشار
α4β1فبرونيكتين ، VCAM-1الخلايا المكونة للدم
α5β1فبرونيكتينالليفية
α6β1لامينينواسع الانتشار
α6β4لامينينالخلايا الظهارية
αLβ2ICAM-1 و ICAM-2الخلايا اللمفاوية التائية
αllbβ3فبرونيكتين ، الفيبرينوجينالصفائح

مع هذا التنوع ، ليس من المستغرب ألا تربط جميع الإنتجرينات تسلسلات RGD ، على الرغم من أن معظمها يفعل ذلك. على سبيل المثال ، تفضل α2β1 متواليات YYGDLR أو FYFDLR ، وتربط αIIbβ3 كلاً من RGD وتسلسل KQAGDV بقوة. لقد ثبت أن تنشيط Integrin يبدأ مسارات الإشارات ، ويبدأ كيناز الالتصاق البؤري (FAK) أو عدد قليل من الكينازات المركزية الأخرى ، التي تتحكم في الأنشطة من إعادة ترتيب الهيكل الخلوي إلى بقاء الخلية.

كل من الوحدات الفرعية α و عبارة عن بروتينات عبر الغشاء تمر عبر الغشاء مرة واحدة فقط. تطوريًا ، توجد فقط في الأنواع metazoan ، ولكنها توجد أيضًا في الكل أنواع ميتازوان. جميع الإنتغرينات باستثناء واحد ، α6β4 ، تتصل بالهيكل الخلوي لخيوط الأكتين الدقيقة من خلال المجال السيتوبلازمي للوحدة الفرعية ب. يرتبط α6β4 بالهيكل الخلوي الوسيط الخيطي ، ويرجع ذلك جزئيًا إلى أن المجال السيتوبلازمي β4 كبير جدًا ويمتد أكثر إلى السيتوبلازم. على الجانب خارج الخلية ، يوجد موقع تنسيق أيون معدني يشغله عادة Mg2+، وهذا ضروري لربط الترابط. هناك أيضًا العديد من مواقع ربط الأيونات ثنائية التكافؤ الأخرى ، يمكن العثور على المستقبل إما في حالة غير نشطة (منحنية إلى حد ما نحو الغشاء) أو في حالة نشطة (مستقيمة). في الحالة غير النشطة ، تربط الوحدة الفرعية الوحدة الفرعية عن كثب مما يمنع التفاعل مع الهيكل الخلوي. ومع ذلك ، بمجرد أن يكون المجال السيتوبلازمي للوحدة الفرعية ، فإنه يزيح الوحدة الفرعية ، مما يتسبب في فصل طفيف للوحدتين الفرعيتين ويؤدي إلى تنشيط المستقبل. في الواقع ، تُظهر الإنتغرينات ما يُعرف بالإشارة "من الداخل إلى الخارج" ، حيث تؤدي الإشارة الخلوية (على سبيل المثال ، من سلسلة الإشارات لعامل النمو) إلى تغييرات في المجال السيتوبلازمي والذي يغير شكل المجال خارج الخلية إلى حالة تقويم نشطة يمكن فيها الارتباط بسهولة أكبر بالروابط. هذا هو السبب في أن الإنتجرينات مناسبة تمامًا للالتصاقات البؤرية وغيرها من التصاقات "المتحركة" التي يجب أن تلتصق وتتحرر بسرعة. على الرغم من حدوث إعادة تدوير للمستقبلات أيضًا ، فإن تشغيلها أو إيقاف تشغيلها عن طريق الإشارات من الداخل إلى الخارج يعد آلية فعالة للحركة السريعة.

كما قد يتوقع المرء من هيكل مرتبط بالأكتين ، التصاقات البؤرية و في الجسم الحي المعادلات هي نقاط اتصال ديناميكية عابرة بين الخلية والركيزة التي تزحف عليها. ومع ذلك ، هناك العديد من المواقف التي لا تكون فيها الخلية ثابتة فحسب ، بل تحتاج إلى أن تكون مرتبطة بشدة بركائزها من أجل أن تستعد لأي ضغوطات قد تأتي لاختبار عزمها. في هذه الحالات ، يكون الهيكل الخلوي للأكتين سريع الزوال للغاية بالنسبة لهذه المهمة.


أنشطة البحث

يهدف بحثنا إلى فهم كيفية استجابة الخلايا لتغيرات الخواص الميكانيكية لبيئتها المحيطة. نحن نجمع بين مناهج الكيمياء الحيوية والبيولوجيا الجزيئية والفيزياء الحيوية الكمية لاستكشاف الآليات الجزيئية التي تتحكم في البنية النووية وتعمل استجابة للإجهاد الميكانيكي. تركز المشاريع الحديثة على: كيف ينظم الهيكل النووي التعبير الجيني في الخلايا الوعائية وفي أسلاف الخلايا العصبية ، وكيف ينظم النقل بين الخلايا للإشارات الميكانيكية السلوك الجماعي داخل الظهارة.

طاقم عمل

كريستوف جيلوي ، دكتوراه (قائد المجموعة) [email protected]

Aureille J، Buffière-Ribot V، Harvey BE، Boyault C، Pernet L، Andersen T، Bacola G، Balland M، Fraboulet S، Van Landeghem L، Guilluy C. يتحكم تشوه الغلاف النووي في تقدم دورة الخلية استجابة للقوة الميكانيكية. ممثل EMBO. 2019

Guilluy C و Osborne L و Van Landeghem L و Superfine R و Garcia-mata R و Burridge K. النوى المعزولة تتكيف مع القوة وتكشف عن مسار نقل ميكانيكي داخل النواة. نات سيل بيول. 2014 9 مارس. doi: 10.1038

ينظم كل من Guilluy C و Swaminathan V و Garcia-Mata R و O & # 8217Brien ET و Superfine R و Burridge K. نات سيل بيول. 2011 13 يونيو (6): 722-7

Guilluy C ، Burridge K. النقل الميكانيكي النووي: إجبار النواة على الاستجابة. نواة. 20156(1):19-22

Collins C، Guilluy C، Welch C، O & # 8217Brien ET، Hahn K، Superfine R، Burridge K، Tzima E. قوى التوتر الموضعية على PECAM-1 تثير استجابة نقل ميكانيكي عالمية عبر مسار Integin-RhoA. كور بيول. 2012 نوفمبر 2022 (22): 2087-94

Thompson WR و Guilluy C و Xie Z و Sen B و Brobst KE و Yen SS و Uzer G و Styner M و Case N و Burridge K و Rubin J. يستخدم Fyn المنشط ميكانيكيًا mTORC2 لتنظيم RhoA وتكوين الدهون في الخلايا الجذعية الوسيطة. الخلايا الجذعية. 2013 31 نوفمبر (11): 2528-37

ساندرين فرابوليت ، دكتوراه (أستاذ مشارك)[email protected]

منشورات مختارة

مرسييه ، م. لابورت ، أو. ديستاينج ، بي بلوت ، سي. بلوين ، ك. بيرنت جالي ، سي شاتيلارد ، واي.سعودي ، سي ألبيجز-ريزو ، سي لاماز ، إس فرابوليت ، إيه بيتيوت ، ر. سادول. ALG-2 البروتين المتفاعل- X (Alix) ضروري للتطعيم المستقل للكلاثرين والتشوير. تقرير علمي. 2016 (6):26986

Chassefeyre، J. Martinez-Hernández، F. Bertaso، N. Bouquier، B. Blot، M. Laporte، S. Fraboulet، Y. Couté، A. Devoy، A. Isaacs، K. Pernet-Gallay، R. Sadoul، إل فاني ، واي.غولدبرغ. تنظيم وظيفة ما بعد التشابك العصبي بواسطة الوحدة الفرعية ESCRT-III المرتبطة بالخرف chmp2b. مجلة علم الأعصاب. 2015 18 35 (7): 3155-73. خطأ في: J Neurosci. 2015 20 35 مايو (20): 8035-7.

تشيفيت ، إف هيمنج ، ك. بيرنت جالي ، إس فرابوليت ، ر. سادول. دور ناشئ من exosomes العصبية في الجهاز العصبي المركزي. أمام فيسيول. 2012 3:145.

Briese، B. Esmaeili، S. Fraboulet، EC Burt، S. Christodoulou، PR Towers، K.E. ديفيز ، دي. ساتيل. يؤدي حذف smn-1 ، وهو مقوم Caenorhabditis elegans لجين الضمور العضلي الشوكي ، إلى خلل وظيفي في الحركة ويقلل من العمر الافتراضي. همهمة مول جينيه. 2009 18(1):97-104.

ماهول ميلير ، إف سترابازون ، إيه بيتيو ، سي شاتيلارد-كوز ، إس تورتش ، بي بلوت ، كيه فريمان ، إل كون ، جي غارين ، جي إم فيرنا ، إس فرابوليت ، رسادول. يشارك Alix و ALG-2 في موت الخلايا الناجم عن TNF-R1. J. بيول. تشيم. 2008 283(50):34954-65.

مونيكا الزبيتا دوليجا ، دكتوراه (باحث مشارك) [email protected]

منشورات مختارة

Dolega ME و Delarue M و Ingremeau F و Prost J و Delon A و Cappello G. تكشف مستشعرات الضغط الشبيهة بالخلية عن زيادة الضغط الميكانيكي تجاه قلب الأجسام الشبه الكروية متعددة الخلايا تحت الضغط. نات. كومون. 2017 يناير 278: 14056. دوى: 10.1038 / ncomms14056.

Dolega ME ، Abeille F ، Picollet-D & # 8217hahan N ، Gidrol X. الثقافة ثلاثية الأبعاد الخاضعة للرقابة في Matrigel microbeads لتحليل تطور الأسينار النسيلي. المواد الحيوية. 2015 يونيو 52: 347-57. دوى: 10.1016 / j.biomaterials.2015.02.042. Epub 2015 3 مارس.

Dolega ME و Wagh J و Gerbaud S و Kermarrec F و Alcaraz JP و Martin DK و Gidrol X و Picollet-D & # 8217hahan. يوفر التصنيع المريح لسطح مقاعد البدلاء للقنوات الدقيقة الدائرية المغلقة بنية محصورة ثلاثية الأبعاد لنمو الخلايا الظهارية في البروستاتا. بلوس واحد. 2014 يونيو 199 (6): e99416. دوى: 10.1371 / journal.pone.0099416. eCollection 2014.

ليديا بيرنيت ، دكتوراه (مهندس) [email protected]

المسؤوليات في المختبر:

& # 8211 تجارب في الكيمياء الحيوية والبيولوجيا الجزيئية والخلوية
& # 8211 صيانة خط ثقافة الخلية
& # 8211 تطوير تجارب ATACseq

& # 8211 البيولوجيا الجزيئية - & GT qPCR
& # 8211 الصحة والسلامة à مساعد الوقاية ومسعف أول في مكان العمل

& # 8211 مسؤول عن صيانة غرفة الثقافة
& # 8211 إشراف الطلاب
& # 8211 مدير المشتريات


فك اقتران الالتصاق والتأشير بإنتجرين: βملاحظة المجال السيتوبلازمي كافٍ لتنظيم التعبير الجيني في ذبابة الفاكهة الجنين

تعتبر مستقبلات سطح خلية إنتجرين مناسبة بشكل مثالي لتنسيق التمايز الخلوي وتجميع الأنسجة أثناء التطور الجنيني ، حيث يمكنها التوسط في كل من الإشارات والالتصاق. نبيِّن أن الإنتجرينات تنظم التعبير الجيني في الجنين النامي السليم من خلال تحديد جينين يتطلبان وظيفة الإنتجرين لتعبيرهما الطبيعي فيذبابة الفاكهة خلايا الأديم الباطن المعى المتوسط. لقد حددنا الأدوار النسبية لالتصاق الإنتجرين مقابل الإشارة في تنظيم هذه الجينات المستهدفة من الإنتجرين. نجد أن الالتصاق بوساطة الإنتجرين ليس مطلوبًا بين خلايا الأديم الباطن والأديم المتوسط ​​الحشوي من أجل التعبير الجيني المستهدف لإنتجرين. بالإضافة إلى ذلك ، يمكن للبروتين الخيمري الذي يفتقر إلى وظيفة الإنتجرين اللاصقة ، ولكنه يحافظ على القدرة على الإشارة ، أن يكون بديلاً عن الإنتجرين الداخلي ، وينظم الجينات المستهدفة للإنتجرين. يتكون هذا الوهم من مجال قليل القسيمات خارج الخلية مدمج في الإنتجرين βملاحظة المجال السيتوبلازمي للوحدة الفرعية ، وهو انصهار مجال أحادي خارج الخلية للتحكم لا يغير التعبير الجيني المستهدف لإنتجرين. لذلك ، قلة قلة الحمض الأميني 47ملاحظة المجال داخل الخلايا كافٍ لبدء مسار إشارات ينظم التعبير الجيني في الجنين النامي.


المنشورات

كامبل ، إتش ، سالفي ، إيه ، أو & # 8217 براين الثاني ، إي تي ، سوبرفاين ، آر ، & أمبير ديمالي ، ك. (2019). & # 8220PAK2 يربط بقاء الخلية بالنقل الميكانيكي والتمثيل الغذائي. & # 8221 Journal of Cell Biology 218 (6): 1958-1971. PMC6548143

Liu، B.، Hobson، C.M.، Pimenta، FM، Nelsen، E.، Hsiao، J.، O & # 8217Brien، ET، Falvo، M.R.، Hahn، K.M.، and Superfine، R. (2019). & # 8220VIEW-MOD: محرك إضاءة متعدد الاستخدامات بتصميم بصري معياري للفحص المجهري الفلوري. & # 8221 Optics Express 27 (14): 19950-19972. NIHMS1053869

Marston DJ ، Anderson ، K.L. ، Swift ، M.F. ، Rougie ، M. ، Page ، C. ، Hahn ، K.M. ، Volkmann ، N. ، and Hanein ، D. (2019). يتم ترجمة نشاط High Rac1 وظيفيًا إلى هياكل خلوية ذات بنية هيكلية هيكلية نانوية فريدة من نوعها. PNAS. 116 (4): 1267-72. Epub 2019 10 يناير. PMC6347697. بي دي إف

Beicker K، O & # 8217Brien III، ET، Falvo، M.R.، and Superfine، R. (2018). ورقة الضوء العمودي التصوير الجانبي المحسن لدراسات ميكانيكا الخلايا AFM. التقارير العلمية. 8 (1504). 8 (1): 1504. PMC5784156. بي دي إف

كاربنتر J ، لينش ، إس إي ، كريب ، ج.أ ، كيلسترا ، إس ، هيل ، دي بي ، وأمبير سوبرفاين ، ر. (2018). يتم نقل المصارف العازلة والمخاط إلى أعلى في فحص مائل لإزالة المخاط. المجلة الأمريكية لعلم وظائف الأعضاء & # 8211 علم وظائف الأعضاء الجزيئية لخلايا الرئة. Epub 2018 13 سبتمبر. DOI 10.1152 / ajplung.00274.2018.PMC6295511 PDF

Dagliyan O، Krokhotin، A.، Ozkan-Dagliyan، I.، Deiters، A.، Der، CJ، Hahn، K.M، Dokholyan، NV (2018). التصميم الحسابي للبروتينات الانقسام الوراثي الكيميائي والبروتيني. اتصالات الطبيعة. 9 (1): 4042. PMC6168510. بي دي إف

Eicher JE و Kapustina و M. و Falvo و M. و Jacobson و K. مجلة الفيزياء الحيوية سان فرانسيسكو ، كاليفورنيا 2018. ص. 16A-7A. خلاصة PDF

جوديث آر إم ، لانهام ، بي ، فالفو ، إم آر ، وأمبير سوبرفاين ، آر. (2018). قياس اللزوجة ميكروفلويديك باستخدام صفائف micropost المشغلة مغناطيسيًا. بلوس واحد. 13 (7): e0200345. PMC6049921 PDF

Ma X ، Dagliyan ، O. ، Hahn ، K.M. ، and Danuser ، G. ، (2018). التنميط الديناميكا التشكلية الخلوية عن طريق تحلل الطيف الزماني المكاني. PLoS علم الأحياء الحسابي. 14 (8): e1006321. Epub 2018 أغسطس دوى. 10.1371 / journal.pcbi.1006321. PMC6091976. بي دي إف

Nelsen E، Hobson، C.، Hsiao، J.، Falvo، M.، O & # 8217Brien III، ET، Watanabe، T.، Hahn، K.، and Superfine، R. Force Spectroscopy of Phagocytosis with High Frame Rate 3D Light تصوير الورقة. الاجتماع السنوي الثاني والستون لجمعية الفيزياء الحيوية سان فرانسيسكو ، كاليفورنيا 2018. ص. 530 أ. الملخص بي دي إف

Shao C، Cribb، J.، Osborne، L.D.، O & # 8217Brien III، ET، Superfine، R.، Mayer-Patel، K.، and Taylor II، R.M. (2018). ضغط الفيديو المجهري الإدراك للتحليل. تقنية البحث المجهري. 81 (7): 693-703. بي دي إف

Stefanini L، Lee، RH، Paul، DS، O & # 8217Shaughnessy، EC، Ghalloussi، D.، Jones، CI، Boulaftali، Y.، Poe، KO، Piatt، R.، Kechele، DO، Caron، KM، Hahn، KM ، Gimmins ، J. ، M. ، and Bergmeier ، W. ، (2018). التكرار الوظيفي بين الأشكال الإسوية RAP1 في إنتاج الصفائح الدموية الفئران ووظيفتها. دم. 132 (18): 1951-62. Epub 2018 21 أغسطس ، PMC6213319. بي دي إف

Tarbet HJ، Dolat، L.، Smith، T.J.، Condon، BM، O & # 8217Brien III، ET، Vladivia، RH، and Boyce، M. (2018). ينظم الارتباط بالجليكوزيل الخاص بالموقع شكل ووظيفة الهيكل الخلوي الوسيط ELIFE. 7. Epub 7 مارس 2018 PMC5841932 PDF

Tajadura-Ortega، V.، Garg، R.، Allen، R.، Owczarek، C.، Bright، MD، Kean، S.، Mohd-Noor، A.، Grigoriadis، A.، Elston، TC، Hahn، KM ، ريدلي ، AJ (2018). تحدد شاشة RNAi لشبكات إشارات Rho RhoH كمنظم لـ Rac1 في هجرة خلايا سرطان البروستاتا. علم الأحياء BMC. 16 (1): 29. PMC5840776. بي دي إف

فان هارين J ، شرف الدين ، RA ، Ettinger ، A. ، Wang ، H. ، Hahn ، K.M. ، and Wittman ، T. (2018). التحكم المحلي في ديناميات الأنابيب الدقيقة داخل الخلايا عن طريق تفكك الصور EB1. بيولوجيا خلية الطبيعة. 20 (3): 1504. PMC5826794. بي دي إف

Woroniuk A، Porter، A.، White، G.، Newman، DT، Diamontopoulou، Z.، Waring، T.، Rooney، C.، Strathdee، D.، Marston، DJ، Hahn، KM، Sansom، oJ، Zech ، ت. ، وماليري ، أ. (2018). ينظم نشاط Rac1 بوساطة STEF / TIAM2 في الغلاف النووي غطاء الأكتين المحيط بالنواة. اتصالات الطبيعة. 2 (9): 1. PMC5974301. بي دي إف

يان سي ، وانغ ، إف ، بينغ ، واي ، ويليامز ، سي آر ، جينكينز ، بي ، ويلدونجر ، جي ، كيم ، إتش جي ، بير ، جي بي ، فوغان ، جي سي ، كيرن ، مي ، فالفو ، MR ، O & # 8217 براين III ، ET ، Superfine ، R. ، Tuthill ، JC ، Xiang ، y. ، Rogers ، SL ، & amp Parrish ، JZ (2018). مطلوب أستلة الأنابيب الدقيقة من أجل التحسس الميكانيكي في ذبابة الفاكهة. تقارير الخلية. 25 (4): 105-1065. PMC6248335 PDF

Yumerefendi H ، Wang ، H. ، Dickinson ، D.J. ، Lerner ، AM ، Malkus ، P ، Goldstein ، B. ، Hahn ، K. ، and Kuhlman ، B. (2018). يعزز التوظيف السيتوبلازمي المعتمد على الضوء النطاق الديناميكي للتحويل الضوئي للواردات النووية. تشيمبيوتشيم. 19 (20): 1319-1325. PMC6013380. بي دي إف

Dagliyan O. ، Karginov ، A.V. ، Yagishita ، S. ، Gale ، ME ، Wang ، H. ، DerMardirossian ، C. ، Wells ، C.M. ، Dokholyan ، NV ، Kasai ، H. (2017). مفاتيح التحويل الهندسي Pak1 Allosteric. علم الأحياء الاصطناعية ACS. 6 (7): 1257-62. PMC5562282. بي دي إف

Hendrickx-Rodriguez S، Falvo، M.R.، O & # 8217 Brien III، ET، and Superfine، R. تأثيرات كثافة Opsonin ونوعها على البلعمة للخرز. المجلة الفيزيائية الحيوية 2017. ص. 90A-1A. & # 8211 الملخص

Herrington K.A.، Trinh، A.L.، Dang، C.، O & # 8217Shaughnessy، E.، Hahn، K.M.، Gratton، E.، Digman، MA and Sütterlin، C. (2017). يكشف التحليل المكاني لنشاط Cdc42 عن دور Cdc42 المرتبط بغشاء البلازما في تنظيم الجسيم المركزي. البيولوجيا الجزيئية للخلية. 28 (15): 2135-45. PMC5509425. بي دي إف

ماركوفيتز إم آر ، سيم ، آي ، رامزي ، كيه ، جاربارين ، آي سي ، فورست ، جي إم ، شولتز ، إيه ، ستيك ، إس ، باوتشر ، آر سي. تقييم المؤشرات الحيوية القائمة على المخاط لمرض مجرى الهواء التليفزيوني. أمراض الرئة لدى الأطفال 2017. ص. S258. & # 8211 الملخص

Takano T. ، م ، هان ، KM وكايبوتشي ، ك. (2017). اكتشاف الإشارات المثبطة بعيدة المدى لضمان تكوين 0.3 محور عصبي فردي. اتصالات الطبيعة. 8 (1): 33. PMC5484694. بي دي إف

تايلور AB ، جوانو ، إم إس ، واتانابي ، T. ، هان ، K. ، وتشو ، T.L. (2017). عرض دقيق بشكل ملموس لصورتين باللون الرمادي كصورة ملونة واحدة. مجلة المجهر. 268 (1): 73-83. PMC5637524. بي دي إف

Walton BL ، Hehmann ، M. ، Skorczewski ، T. ، Holle ، LA ، Beckman ، JD ، Cribb ، JA ، Mooberry ، MJ ، Wufsus ، AR ، Cooley ، BC ، Homeister ، JW ، Pawlinski ، R. ، Falvo ، MR ، Key، NS، Fogelson، AL، Neeves، KB، and Wolberg، AS (2017). الهيماتوكريت المرتفع يعزز تراكم الصفائح الدموية بعد إصابة الأوعية الدموية. دم. دوى: 746479. PMC5418635 PDF

Woodham EF، Paul، NR، Tyrrell، B.، Spence، HJ، Swaminathan، K.، Scribner، MR، Giampazolias، E.، Hedley، A.، Clark، W.، Kage، F.، Marston، DJ، Hahn ، KM ، Tait ، SW ، Larue ، L. ، Brakebusch ، CH ، Insall ، RH and Machesky ، LM (2017). التنسيق بواسطة Cdc42 للأكتين ، والانقباض ، والالتصاق لحركة الخلايا الصباغية في جلد الفأر. علم الأحياء الحالي. 27 (5): 624-37. PMC5344686. بي دي إف

Ye F. ، Yang ، C. ، Kim ، J. ، MacNevin ، CJ ، Hahn ، K.M. ، Park ، D. ، Ginsberg ، M.H. ، and Kim ، C. (2017). Epigallocatechin Gallate له تأثيرات متعددة الاتجاهات على إشارات عبر الغشاء عن طريق تغيير تضمين المجالات عبر الغشاء. مجلة الكيمياء البيولوجية. 262 (24): 9858-64. PMC5473239. بي دي إف

Blackmon، R.L.، Sandhu، R.، Chapman، BS، Casbas-Hernandez، P.، Tracy، J.B.، Troester، MA، and Oldenburg، AL (2016) مجلة بيوفيزيائية. 110 (8): 1858-68. PMC4850325. بي دي إف

Burridge K، and Guilluy، C. (2016).الالتصاقات البؤرية وألياف الضغط والتوتر الميكانيكي. أبحاث الخلايا التجريبية. S0014-4827 (15): 30131-2. PMC4891215 PDF

Cribb JA، Osborne، LD، Beicker، K.، Psioda، M.، Chen، J.، O & # 8217Brien، ET، Taylor II، RM، Vicci، L.، Hsiao، JP، Shao، C.، Falvo، M .، Ibrahim، JG، Wood، KC، Blobe، GC، & amp Superfine، R. (2016). مجهر مصفوفة آلي عالي الإنتاجية لميكانيكا الخلايا السرطانية. التقارير العلمية. 6: 27371. PMC4893602 PDF

Dagliyan، O.، Tarnawski، M.، Chu، P.H.، Shirvanyants، D.، Schlichting، I.، Dokholyan، NV، and Hahn، K.M. (2016) هندسة الاضطراب الخارجي للتحكم في نشاط البروتين في الخلايا الحية. علم. 354 (6318): 1441-1444. PMC5362825 PDF

Evans BA ، Ronecker ، JC ، Han ، D.T. ، Glass ، D.R. ، Train ، TL ، and Deatsch ، Alison ، E. (2016). نفاذية عالية المجهرية سيليكون وظيفية مع تألق ذاتي منخفض للتطبيقات الطبية الحيوية. إلسفير. Epub 16 فبراير 2016. doi: 10.1016 / j.msec.2016.01.094 PDF

Farzal Z، Walsh، J.، Lopes de Rezende Barbosa، G.، Zdanski، CJ، Davis، S.D، Superfine، R.، Pimenta، LA، Kimbell، J.S.، and Drake، AF (2016). تحليل تجويف الأنف الحجمي عند الأطفال الذين يعانون من الشفة المشقوقة من جانب واحد وثنائي الشفة والحنك. منظار الحنجرة. 126 (6): 1475-1480. PMC4752420 PDF

Gentry L.R. ، Karginov A.V. ، Hahn K.M. ، Der CJ (2016) توصيف Src Kinase هندسيًا لدراسة إشارات Src وعلم الأحياء. طرق البيولوجيا الجزيئية. 1360: 157-167. PMC4621786. بي دي إف

Givens، C.، and Tzima، E. (2016) التشوير الميكانيكي البطاني: هل جهاز استشعار واحد يناسب الجميع؟ إشارة الأكسدة والاختزال المضادة للأكسدة. 25 (7): 373-388. PMC5011625 PDF

Lawrimore J، Aicher، J.، Hahn، P.، Fulp، A.، Kompa، B.، Vicci، L.، Falvo، M.، Taylor II، R.، and Bloom، K. (2016). ChromoShake: جهاز محاكاة ديناميكيات كروموسوم يكشف عن حلقات كروماتين تصلب الكروماتين المركزي. البيولوجيا الجزيئية للخلية. 27 (1): 153-66. PMC4694754. بي دي إف

MacNevin CJ، Toutchkine، A.، Marston، D.J.، Hsu، C-W.، Tsygankov، D.، Li، L.، Liu، B.، Qi، T.، Nguyen، D-V.، and Hahn، K.M. (2016). يتيح التصوير المتطاير باستخدام صبغة واحدة التصور المتزامن لتنشيط Rac1 و Cdc42. مجلة الجمعية الكيميائية الأمريكية. 138 (8): 2571-5. PMC4825053 PDF

Marjoram RJ ، Guilluy ، C. ، and Burridge ، K. (2016). استخدام المغناطيس والخرز المغناطيسي لتشريح مسارات الإشارات التي يتم تنشيطها بواسطة التوتر الميكانيكي المطبق على الخلايا. طرق 94: 19-26. PMC4761479. بي دي إف

طرق وأنظمة لاستخدام الوظائف المثبتة على السطح لريولوجيا الموائع الحيوية ، R.

Quammen، CW، Taylor II، RM، Krajcevski، P.، Mitran، S.، Enquobahrie، A.، Superfine، R.، Davis، B.، Davis، S.، and Zdanski، C. (2016) The Virtual Pediatric منضدة الخطوط الجوية. دراسات في التكنولوجيا الصحية والمعلوماتية. 220: 295-300.PMC5588666 PDF

سكوت دويتشه فيله ، تولبرت ، CE ، & amp Burridge ، K (2016). ينشط التوتر على JAM-A RhoA عبر GEF-H1 و p115 RhoGEF. البيولوجيا الجزيئية للخلية. 27 (9): 1420-30. PMC4850030. بي دي إف

Spieser، DL، Gagnon، YL، Chhetri، RK، Oldenburg، AL، and Johnsen، S. (2016) فحص تأثيرات الانحراف اللوني ومسافة الكائن وشكل العين على تكوين الصورة في عيون الخليج المستندة إلى المرآة الإسكالوب Argopecten irradians. علم الأحياء التكاملي والمقارن. 56 (5): 796-808.PMC5886045 PDF

وانغ ، هـ ، فيليلا ، إم ، وينك ، إيه ، تارناوسكي ، إم ، شليشتينج ، آي ، يوميرفيندي ، إتش ، كولمان ، بي ، ليو ، آر ، دانوسر ، جي ، وهان ، كم (2016) LOVTRAP: نظام البصريات الوراثي لتفكك البروتين الضوئي. طرق الطبيعة. 13 (9): 755-758. PMC5137947 PDF

وانغ ، هـ ، وهان ، ك. (2016) LOVTRAP: طريقة متعددة الاستخدامات للتحكم في وظيفة البروتين بالضوء. البروتوكولات الحالية في بيولوجيا الخلية. 73:21. PMC5137945. بي دي إف

بوكاي ، آي ، أو & # 8217 براين الثالث ، إي تي ، وولف ، إس ، سوبرفاين ، آر ، وولبيرج ، إيه ، فالفو ، إم ، وهدسون ، إن. (2015). المحددات الفيزيائية لانحلال الفبرين في ألياف الفبرين المفردة. بلوس واحد. DOI: 10.1371 / journal.pone.011635. PMC4340865 PDF

كراسوس جي جي ، ميهوت ، إيه إم ، مانسون ، إل كي ، وشورتينبيرجر ، ب. (2015). ميكروجيلات متباينة الخواص متجاوبة مع شكل وتفاعلات قابلة للضبط. مقياس النانو. 7 (38): 15971-82. بي دي إف

Cribb، J.، Osborne، L.، Hsiao، J.، Vicci، L.، Meshram، A.، O & # 8217Brien III، ET، Spero، R.، Taylor II، R.، and Superfine، R. (2015 ). مجهر مصفوفة عالية الإنتاجية للتوصيف الميكانيكي للمواد الحيوية. مراجعة AIP للأدوات العلمية 86 (023711). PMC4344474 PDF

Du K، Zheng، S.، Zhang، Q.، Li، S.، Gao، X.، Wang، J.، Jiang، L.، and Liu، K. (2015). يعزز حذف Pten إعادة نمو محاور السبيل القشري بعد عام من إصابة الحبل الشوكي. مجلة علم الأعصاب. 35 (26): 9754-63. بي دي إف

Fiser B، Shields، A.، Falvo، M.، and Superfine، R. (2015). مصفوفات ميكروكتور ذات هيكل أساسي عالي الاستجابة للاستخدام في السوائل اللزجة والمطاطية اللزجة. مجلة الميكانيكا الدقيقة والهندسة الدقيقة 25 (2). PMC4577244 PDF

Grube M و Cernava و T. و Sho و J. و Fuchs و S. و Aschenbrenner و I. و Lassek و C. و Wegner و U. و Becher و D. و Riedel و K. و Sensen و CW و Berg ، (2015). استكشاف السياقات الوظيفية للاستدامة التكافلية داخل البكتيريا المرتبطة بالحزاز عن طريق المقارنات النطاقية. مجلة ISME. 9 (2): 412-24. PMC4303634. PMC4303634 PDF

Guilluy C ، Burridge ، K. (2015). النقل الميكانيكي النووي: إجبار النواة على الاستجابة. نواة. 6 (1): 19-22. PMC4615784. PMC4615784 PDF

جوديث ، آر ، فيشر ، جيه ، سبيرو ، آر ، فيزر ، بي ، تيرنر ، إيه ، أوبيرهاردت ، بي ، تايلور الثاني ، آر ، فالفو ، إم ، سوبرفاين ، آر ، ومختبر تشيب (2015 ). & # 8220 القياس المرن الدقيق على جلطات الدم الكاملة باستخدام المشاركات المثبتة على السطح (ASAPs). & # 8221 Lab Chip 15 (5): 1385-1393. PMC4545258 PDF

Lawrimore J، Vasquez، P.A.، Falvo، M.، Taylor II، R.، Vicci، L.، Yeh، E.، Forest MG، and Bloom، K. (2015). تولد حلقات الحمض النووي توترًا داخل المركز في الانقسام الفتيلي. مجلة بيولوجيا الخلية. 210 (4): 553-64. PMC4539978 PDF

Li، S.، He، Q.، Wang، H.، Tang، X.، Ho، KW، Gao، X.، Zhang، Q.، Shen، Y.، Cheung، A.، Wong، F.، Ip ، NY، Jiang، L.، Yung، WH، and Liu، K. (2015). محاور شبكية مصابة بالغة مع Pten و Socs3 تعمل على الحذف المشترك لإصلاح المشابك العصبية مع الخلايا العصبية فوق التصالبية. البيولوجيا العصبية للمرض. 73: 366-76. بي دي إف

Mair l، Weinberg، I.، Nacev، A.، Urdaneta، M.، Stepanov، P.، Hilaman، R.، Himelfarb، S.، and Superfine، R. (2015). تحليل النقل النانوي الدافع من خلال مصفوفة البوليمر الحيوي. مجلة المغناطيسية والمواد المغناطيسية. 380: 295-298 PMC4321758 PDF

موراي إي ، سيار ، س ، طومسون ، كولومبيا البريطانية ، جوركين الثالث ، ر. ، ضابط ، DL ، والاس ، ج. (2015). طريق صديق للبيئة وصديق للبيئة لمركبات الجرافين / البوليمر القابلة للمعالجة والمتوافقة حيويًا. تقدم RSC. 5 (56): 45284-90. بي دي إف

سيرز ، بي ، بلاكمون ، آر ، لينش ، إس ، سوبرفاين ، آر ، أولدنبورغ ، إيه ، وأوستروفسكي ، إل إي. (2015) النقل المخاطي الهدبي في الثقافات الدائرية للخلايا الظهارية لمجرى الهواء البشري الأولي: تأثير تردد الضرب الهدبي وتركيز المخاط. رئوي الأطفال. 50: 234-235. الملخص

Shao C، Zhong، A.، Cribb، J.، Osborne، L.D.، O & # 8217Brien III، ET، Superfine، R.، Mayer-Patel، K.، Taylor II، R.M. (2015). ضغط الفيديو المجهري للمحافظة على التحليل من خلال الارتباط والتشكيل الرياضي. بحوث وتقنيات الفحص المجهري. PMC4715596. بي دي إف

قصير ب (2015). يتصاعد التوتر عند الحلقات المركزية. مجلة بيولوجيا الخلية. 210 (4): 523. بي دي إف

Vicory J، Couture، HD، Thomas، N.E.، Borland، D.، Marron، JS، Woosley، J.، and Niethammer، M. (2015). تطبيع مظهر شرائح الأنسجة. التصوير الطبي المحوسب والرسومات. 43: 89-98. PMC4769595. PMC4769595 PDF

Wen B ، كامبل ، K.R. ، Cox ، B.L. ، Eliceiri ، K.W. ، Superfine ، R. ، and Campagnola ، P. في: Letters O ، محرر. يوليو 2015: جمعية البصريات الأمريكية 2015. ص. 3201-4. PMC4979975 PDF

Yi JJ ، Berrios ، J. ، Newbern ، J.M. ، Snider ، W.D. ، Philpot ، BD ، Hahn ، K.M. ، and Zylka ، M.J. (2015). تؤدي الطفرة المرتبطة بالتوحد إلى تعطيل التحكم في الفسفرة في UBE3A. زنزانة. 162 (4): 795-807. PMC4537845. PMC4537845 PDF

Yumerefendi H، Dickinson، D.J.، Wang، H.، Zimmerman، S.P.، Bear، J.E.، Goldstein، B.، Hahn، K.، and Kuhlman، B. (2015). التحكم في نشاط البروتين ومواصفات الخلية عن طريق النقل النووي بوساطة الضوء. بلوس واحد. 10 (6): E0128443. PMC4471001. PMC4471001 PDF

Zdanski C، Davis، S.، Hong، Y.، Miao، D.، Quammen، C.، Mitran، S.، Davis، B.، Niethammer، M.، Kimbll، J.، Pitkin، E.، Fine، J. ، Fordham ، L. ، Vaughn ، B. ، and Superfine ، R. (2015). التقييم الكمي لمجرى الهواء العلوي عند الرضع والأطفال الذين يعانون من تضيق تحت المزمار. منظار الحنجرة. PMC5257243 PDF

Bays J، Peng، X.، Tolbert، E.، Guilluy، C.، Angell، A.، Pany، Y.، Superfine، R.، Burridge، K.، & amp Demali، A (2014). تنظم فسفرة الفينكولين بشكل تفاضلي النقل الميكانيكي في التصاقات الخلية الخلوية والمصفوفة الخلوية. مجلة بيولوجيا الخلية. 205 (2): 251-63. PMC4003237. بي دي إف

Beicker KN، O & # 8217Brien III، ET، Falvo، M.، & amp Superfine، R. (2014). مشاهدة التشوه النووي بالمجهر الجانبي. جمعية الفيزياء الحيوية 106 (2): 42A-43A. (نبذة مختصرة)

بلوم كانساس (2014). الهيتروكروماتين المركزي: آلة الفصل البدائية. المراجعة السنوية لعلم الوراثة. (48): 457-84. PMC4245377. بي دي إف

Chhetri، R.، K.، Blackmon، R.، Wu، W.-C، Hill، DB، button، B.، Casbas-Hernandez، P.، Troester، M.، Tracy، JB، and Oldenburg، AL (2014). & # 8220 البحث عن علم النانو البيولوجي عن طريق نشر العصي النانوية البلازمية المقيدة بشكل ضعيف مع التصوير المقطعي البصري. & # 8221 وقائع الأكاديمية الوطنية للعلوم 111 (41): E42897-E44297. PMC4205670. بي دي إف

Collins، C، Osborne، L.، Guilluy C.، Chen، Z.، O & # 8217Brien III، E.، Reader، J.، Burridge، K.، Superfine، R.، & amp Tzima، E. (2014) Haemodynamic وتنظم إشارات المصفوفة خارج الخلية النمط الظاهري الميكانيكي وصلابة الخلايا البطانية الأبهرية. اتصالات الطبيعة 5: 3984. دوى: 10.1038 / ncomms4984 PMC4068264 PDF

ديفيدسون وارد س. ، أمين ، ر. ، أرينز ، آر ، تشين ، زد ، ديفيس ، س. ، جوتمارك ، إي ، سوبرفاين ، ر. ، وونج ، ب ، زدانسكي ، سي ، وكهو ، إم. (2014). اضطرابات التنفس المتعلقة بالنوم لدى الأطفال: متقدمة في التصوير والنمذجة الحاسوبية. نبض IEEE. (سبتمبر / أكتوبر): 33-9. بي دي إف

فيشر جي ، وأمبير كليكنر ، إن. (2014). مكبس مغناطيسي ذو قوة مغناطيسية: جهاز متكامل للقوة / موائع جزيئية لتطبيق قوى الضغط في بيئة محصورة. مراجعة الأدوات العلمية. 85 (2): 023704. PMC3970836 PDF

Guilluy، C، Osborne، LD، Van Landeghem، L.، Sharek، L.، Superfine، R.، Garcia-Mata، R.، and Burridge، K. (2014) تتكيف النوى المعزولة مع القوة وتكشف عن مسار نقل ميكانيكي في النواة. بيولوجيا خلية الطبيعة. 16 (4): 376-381. PMC4085695 PDF

Hill D، Vasques، P.، Mellnik، J.، McKinley، S.، Vose، A.، Mu، F.، Henderson، A.، Donaldson، S، Alexis، N.، Boucher، R.، & amp Forest، م (2014). أساس فيزيائي حيوي لتركيز المواد الصلبة المخاطية كمؤشر بيولوجي مرشح لمرض المسالك الهوائية. بلوس واحد. 9 (2): e87681. PMC3928107. بي دي إف

Hong Y، Davis، B.، Marron، JS، Kwitt، R.، Sing، N.، Kimbell، JS، Pitkin، E.، Superfine، R.، Davis، SD، Zdanski، CJ، & amp Niethammer، M. ( 2014). بناء الأطلس الإحصائي عن طريق المربعات الوظيفية الموزونة. تحليل الصورة الطبية. 18 (4): 684-98. PMC4029168. بي دي إف

هونغ واي ، سينغ ، إن ، كويت ، آر ، فاسكونسيلوس ، إن ، ونيثامر ، إم ، (2014). الانحدار الجيوديسي على Grassmannian. وقائع المؤتمر الأوروبي للرؤية الحاسوبية. (مرجعية ، 15 صفحة) PDF

Hong Y، Gao Y، Niethammer M، Bouix S. 2014. تحليل الشكل المستند إلى العمق. وقائع المؤتمر الدولي لحوسبة الصور الطبية والتدخل بمساعدة الكمبيوتر (MICCAI). (محكم ، 8 صفحات). جائزة الطالب لأفضل ورقة. بي دي إف

هونغ واي ، سينغ ، إن ، كويت ، آر ، ونيثامر ، إم (2014). الانحدار الجيوديسي المشوه بالزمن. وقائع المؤتمر الدولي لحوسبة الصور الطبية والتدخل بمساعدة الحاسوب. (مرجعية ، 8 صفحات) PDF

Huang L، Hsiao، J.P.، Poierza، C. Taylor II، R.، and Lord، S. (2014). هل تعمل الطوبولوجيا على دفع بلمرة الألياف؟ الكيمياء الحيوية. 53 (49): 7824-34. PMC4270379. بي دي إف

Lee، W.، Leddy، HA، Chen، Y.، Lee، SH، Zelenski، NA، McNulty، AL، Wu، J.، Bieker، K.، Coles، J.، Zauscher، S.، Sachs، J. ، Guilak ، F. ، and Liedtke ، W. (2014). & # 8220Synergy بين قنوات Piezo1 و Piezo2 تمنح حساسية ميكانيكية عالية الضغط للغضروف المفصلي. & # 8221 وقائع الأكاديمية الوطنية للعلوم 111 (47): E5114-E5522. PMC4250098. بي دي إف

ليسي موريون ، إي ، أوزبورن ، إل ، موناغان بنسون ، إي ، جيلوي ، سي ، أو & # 8217 براين الثالث ، إي تي ، سوبر فاين ، آر ، & أمبير بوريدج ، ك. (2014) The RhoA GEF ، LARG ، يتوسط النقل الميكانيكي المعتمد على ICAM-1 في الخلايا البطانية لتحفيز الهجرة عبر البطانة. مجلة علم المناعة. 192 (7): 3390-3398. PMC3991232 PDF

Mair LO ، و Superfine ، R. (2014). يكشف تتبع الجسيمات الفردية عن النقل ثنائي الطور أثناء الرحلان المغناطيسي النانوي من خلال المصفوفة خارج الخلية. مادة ناعمة. 10 (23): 4118-25. PMC4265469 PDF

مردقورام ، R.J. ، ليسي ، EC ، & amp Burridge ، K. (2014). تنظيم نشاط RhoA بواسطة جزيئات الالتصاق والنقل الميكانيكي. الطب الجزيئي الحالي. 14 (2): 199-208. PMC3929014. بي دي إف

Mellnik J، Vasquez، PA، McKinley، SA، Witten، J.، Hill، DB، Forest، M.G. (2014). مقاييس التغايرية الدقيقة للانتشار في المادة اللينة. مادة ناعمة. 10 (39): 7781-96. PMC4186960. بي دي إف

أوزبورن ، إل دي ، لي ، جي زي ، كيف ، تي ، أو & # 8217 براين ، إي تي. 3rd ، Blobe GC ، Superfine ، R. ، و Mythreye ، K. (2014). & # 8220TGF-ينظم LARG و GEF-H1 أثناء EMT للتأثير على تقوية الاستجابة لغزو القوة والخلية. & # 8221 البيولوجيا الجزيئية للخلية 25 (22): 3528-3540. PMC4230614. بي دي إف

Osborne LD، Cribb، J.، Vicci، L.، O & # 8217Brien III E.T.، Hsiao، J.، Taylor، R.M. II، & amp Superfine، R. (2014). مجموعة مجهر لتوصيف صلابة عالية الإنتاجية لبيولوجيا السرطان. جمعية الفيزياء الحيوية 106 (2): 619A-619A. (نبذة مختصرة)

شان إل ، زاك ، سي ، تشارلز ، سي ، ونيثامر ، إم ، (2014). التقسيم التلقائي للغضروف ثلاثي الملصقات المستند إلى أطلس من MR Knee Images. تحليل الصورة الطبية. 18 (7): 1233-46. بي دي إف

Sing N، Couture، HD، Marron، J.S، Perou، C.، & amp Niethammer، M. الواصفات الطوبولوجية لصور الأنسجة. التعلم الآلي في التصوير الطبي: Springer International Publishing 2014. p. 231-239. فصل في الكتاب. بي دي إف

Sing N ، و Niethammer ، M. ، (2014). مفاتيح لانحدار الصورة Diffeomorphic. وقائع المؤتمر الدولي لحوسبة الصور الطبية والتدخل بمساعدة الكمبيوتر. 17: 121-9. بي دي إف

Taylor II R و Shao و C. و Zhong و A. و Mayer-Patel و K. ، طرق المخترع والأنظمة ووسائط الكمبيوتر القابلة للقراءة لضغط صور الفيديو. طلب براءة الاختراع المؤقت للولايات المتحدة 2014.

تايلور الثاني آر ، وهارتر ، ج. (2014). تعديل الإضاءة العشوائية لكل عنصر لتحسين التتبع البصري. رسومات الكمبيوتر وتطبيقات IEEE. 34 (6): 83-87. بي دي إف

تومسون إم ، تولبرت ، سي ، شين ، كيه ، كوتا ، بي ، بالمر ، إس ، بليفوك ، ك ، أورلوفا ، إيه ، جالكين ، في ، بوريدج ، ك ، إيجلمان ، إي ، دوكوليان ، N. ، Superfine ، R. ، & amp Campbell ، S. (2014). تحديد سطح ملزم للأكتين على فينكولين يتوسط الخلية الميكانيكية وخصائص الالتصاق البؤري. بنية. 22 (5): 697-706. PMC4039106 PDF

تولبرت سي ، تومسون ، بي إم ، سوبرفاين ، آر ، بوريدج ، ك ، كامبل ، إس إل. (2014). الفسفرة في Y1065 في فينكولين يتوسط تجميع الأكتين ، انتشار الخلايا ، والاستجابات الميكانيكية لفرض الكيمياء الحيوية. 53 (34): 5526-36. PMC4151700. بي دي إف

والدون ، س ، طومسون ، ب ، هان ، ب ، تايلور الثاني ، ر. (2014). & # 8220SketchBio: واجهة عالم ثلاثية الأبعاد للنمذجة الجزيئية والرسوم المتحركة. & # 8221 BMC Bioinformatics Journal 15 (334). PMC4287593 PDF

Wijesundara K، Zdanski، C.، Kimbell، J.، Price، H.، Iftimia، N.، and Oldenburg، AL (2014). التنظير الكمي للمجرى الهوائي العلوي باستخدام التصوير المقطعي البصري التشريحي ذي المصدر المسحوق. البصريات الطبية الحيوية اكسبرس. 5 (3): 788-799. PMC3959831. بي دي إف

زهاو كيو ، بيزر ، س ، نيثامر ، إم ، وروسينمان ، آي ، (2014). مطابقة الرسم البياني الطيفي القائم على الميزات الهندسية في تسجيل السطح البلعومي. وقائع المؤتمر الدولي لحوسبة الصور الطبية والتدخل بمساعدة الحاسوب. (محكم ، 8 صفحات). PMC4382356 PDF

ملحوظة: يستخدم مجتمع علوم الكمبيوتر وقائع المؤتمر كطريقة رئيسية للنشر ، حيث تقل معدلات القبول غالبًا عن 30٪. لذلك فإنهم يتمتعون بوضع المقالات الصحفية المحكمة.

جديد TRD2. مراجع أدوات التصوير الجزيئي الحيوي: نُبلغ عن المراجع الأخيرة لـ TRD PI البروفيسور كلاوس هان. هذا العمل له ليس تم دعمها من قبل CISMM المناسبة خلال العام الماضي ، لكننا أبلغنا هنا لسهولة الوصول والمعلومات عن فرص التعاون.

Helassa N و Garnett JP و Farrant M و Khan F و Pickup JC و Hahn KM و MacNevin CJ و Tarran R و Baines DL. بروتين مستشعر الفلورسنت الجديد لاكتشاف التغيرات في تركيز الجلوكوز السائل على سطح مجرى الهواء. Biochem J. 2014 سبتمبر 15. [Epub قبل الطباعة] PMID: 25220254

Weitzman M ، Hahn KM. نُهج الجينات الوراثية لهجرة الخلايا وما بعدها. خلية أوبين بالعملة بيول. 2014 أكتوبر 30 ج: 112-120. دوى: 10.1016 / j.ceb.2014.08.004. Epub 2014 سبتمبر 15. PMID: 25216352

Chu PH ، و Tsygankov D ، و Berginski ME ، و Dagliyan O ، و Gomez SM ، و Elston TC ، و Karginov AV ، و Hahn KM. يكشف تنشيط كيناز الهندسي عن أنماط ظاهرية شكلية فريدة وما يرتبط بها من تهريب للأشكال الإسوية لعائلة Src. Proc Natl Acad Sci U S A. 2014 أغسطس 26111 (34): 12420-5. دوى: 10.1073 / pnas.1404487111. PMID: 25118278 [PubMed & # 8211 قيد المعالجة]

Tsygankov D، Chu PH، Chen H، Elston TC، Hahn KM. أدوات سهلة الاستخدام لقياس ديناميكيات التشكل الخلوي ومجموعات البروتين داخل الخلايا. طرق خلية بيول. 2014123: 409-27. دوى: 10.1016 / B978-0-12-420138-5.00022-7. PMID: 24974040 [PubMed & # 8211 قيد المعالجة]

Yi JJ ، Wang H ، Vilela M ، Danuser G ، Hahn KM التلاعب في نشاط كيناز الداخلي في الخلايا الحية باستخدام الببتيدات المثبطة للضوء. ACS موالفة بيول. 2014 13 يونيو. PMID: 24905630

Karginov AV ، هان كم ، Deiters A.التنشيط الكيميائي البصري لوظيفة كيناز في الخلايا الحية. 20141148: 31-43. دوى: 10.1007 / 978-1-4939-0470-9_3. PMID: 24718793

تشريح إشارات الحركة من خلال تنشيط مجمعات محددة من المستجيبين Src. نات تشيم بيول. 2014 10 أبريل (4): 286-90. دوى: 10.1038 / nchembio.1477. Epub 2014 مارس 9. Erratum in: Nat Chem Biol. 2014 10 أغسطس (8): 692. PMID: 24609359

Hinde E ، Yokomori K ، Gaus K ، Hahn KM ، Gratton E. التصوير القائم على التقلبات لتفعيل Rac1 النووي عن طريق قلة البروتين. ممثل العلوم .2014 فبراير 274: 4219. دوى: 10.1038 / srep04219. PMID: 24573109

Tsygankov D، Bilancia CG، Vitriol EA، Hahn KM، Peifer M، Elston TC. CellGeo: منصة حسابية لتحليل تغيرات الشكل في الخلايا ذات الأشكال الهندسية المعقدة. J خلية بيول. 2014 فبراير 3204 (3): 443-60. دوى: 10.1083 / jcb.201306067. PMID: 24493591

مورو PK ، Broxson AC ، Munsell MF ، Basen-Enquist K ، Rosenblum CK ، Schover LR ، Nguyen LH ، Hsu L ، Castillo L ، Hahn KM ، Litton JK ، Kwiatkowski DN ، Hortobagyi GN. تأثير العمر والعرق على نوعية الحياة لدى الناجين من سرطان الثدي. كلين سرطان الثدي. 2014 14 أبريل (2): e21-31. دوى: 10.1016 / j.clbc.2013.10.003. Epub 2013 25 أكتوبر. PMID: 24461458

خليل BD ، حنا S ، Saykali BA ، El-Sitt S ، نصر الله A ، Marston D ، El-Sabban M ، Hahn KM ، Symons M ، El-Sibai M تنظيم RhoA في التصاقات البؤرية بواسطة StarD13 مهم لحركة الخلايا النجمية . الدقة خلية الخبرة. 2014 15321 فبراير (2): 109-22. دوى: 10.1016 / j.yexcr.2013.11.023. Epub 2013 10 ديسمبر PMID: 24333506

Cai D و Chen SC و Prasad M و He L و Wang X و Choesmel-Cadamuro V و Sawyer JK و Danuser G و Montell DJ. تعمل التغذية الراجعة الميكانيكية من خلال E-cadherin على تعزيز استشعار الاتجاه أثناء الهجرة الجماعية للخلايا. زنزانة. 2014 22157 مايو (5): 1146-59. دوى: 10.1016 / j.cell.2014.03.045. PMID: 24855950

Martin K ، و Vilela M ، و Jeon NL ، و Danuser G ، و Pertz O. تتيح الوحدة الهيكلية الخلوية المُحدثة بعامل النمو ، والمنظمة المكانية ، الهجرة السريعة والمستمرة للأرومة الليفية. خلية التطوير. 2014 سبتمبر 2930 (6): 701-16. دوى: 10.1016 / j.devcel.2014.07.022. PMID: 25268172

Burridge K ، & amp Wittchen ، E. (2013). تصاعد التوتر: ألياف الإجهاد كمحولات طاقة ميكانيكية مولدة للقوة. مجلة بيولوجيا الخلية. 200 (1): 9-19. PMC3542796. بي دي إف

Calloway ، H. ، Kimbell ، J. ، Davis ، S. ، Retsch-Bogart ، G. ، Pitkin ، E. ، Abode ، K. ، & amp Superfine ، R. (2013). مقارنة بين قياسات مجرى الهواء التنظيرية مقابل 3D CT المشتقة. منظار الحنجرة 123 (9): 2136-2141 بي دي إف

Cao، T.، Jojic، V.، Modla، S.، Powell، D.، Czymmek، K.، & amp Niethammer، M. (2013). تعلم قاموس متعدد الوسائط قوي. . جمعية حوسبة الصور الطبية والتدخل بمساعدة الحاسوب. كتاب الفصل PDF

Cao T، Zach، C.، Modla، S.، Powell، D.، Czymmek، K.، and Niethammer، M. (2014). التسجيل متعدد الوسائط للفحص المجهري المترابط باستخدام تماثلات الصور. تحليل الصورة الطبية. 18 (6): 914-26. PMC4062605. بي دي إف

كولينز ، سي ، وأمبتزيما ، إي (2013). RhoA يذهب إلى العالمية. GTPases صغيرة. 4 (2): 123-126. PMC3747253 PDF

كريب ، ج. ، فاسكيز ، ب ، مور ، ب ، نوريس ، س ، شاه ، س ، فورست ، إم ، سوبرفاين ، ر. (2013). التواقيع غير الخطية في ريولوجيا الميكروبيد النشط لمحاليل البوليمر المتشابكة. مجلة علم الريولوجيا 57 (4): 1247-1264. PMC3920902 PMC3920902 / PDF

Csapo، I، Davis، B.، Shi، Y.، Sanchez، M.، Styner، M.، Niethammer، M. (2013) تسجيل الصورة الطولية مع مقياس تشابه الصورة المعتمد مؤقتًا. معاملات IEEE على التصوير الطبي. 32 (10): 1939-1951. PMC3947578 PMC3947578 / PDF

دوتا ، إس ، هوريتا ، دي ، هانتجان ، آر ، وأمبير جوثولد ، إم (2013). اختبار αIIbβ3: تفاعلات LIGAND بواسطة مطياف القوة الديناميكية واستجابة PLASMON السطحية. نانو لايف .03 (01) PMC3788690 PMC3788690 / PDF

فيشر جي ، بورنيجيل ، إيه ، ويتز ، جي ، وينر ، بي ، برينتيس ، إم ، أند كليكنر ، إن. (2013). التصوير رباعي الأبعاد لتنظيم وديناميكيات الإشريكية القولونية النووية في الخلايا الحية. زنزانة. 153 (4): 882-95. PMC3670778 بي دي إف

Funkhouser 3rd، K.W، Niethammer، M.، Carson، J.، Burns، K.، Knowles، M.، Leigh، M.، Zariwala، M.، & amp Funkhouser Jr، W.K. (2013). تعمل أداة جديدة على تحسين أداء الاختبار التشخيصي لتقييم انتقال EM لأذرع Axonemal Dynein. علم أمراض البنية التحتية. PMC3990650 PDF

Haase، J.، Mishra، P.، Stephens، A.، Haggerty، R.، Quammen، C.، Taylor II، R.، Yeh، E.، Basrai، M.، & amp Bloom، K.، (2013) تكشف خريطة ثلاثية الأبعاد لحركية الخميرة عن وجود هيستون محدد للوسط والملحق. علم الأحياء الحالي. 23 (19): 1936-1944. PMC3796065 PDF

Hanna، S.،، Krishnan، B.، Bailey، S.، Moschos، S.، Kuan، P.، Shimamura، T.، Osborne، L.، Siegel، M.، Duncan، L.، O & # 8217Brien III ، E. ، Superfine ، R. ، Miller ، C. ، Simon ، M. ، Wong. K. ، and Kim ، W. (2013). يقوم كل من HIF1α و HIF2α بتنشيط SRC بشكل مستقل لتعزيز نقائل سرطان الجلد. مجلة التحقيقات السريرية. 123 (5): 2978-2093. PMC3635738 PMC3635738 / PDF

هيرشلاك ، جي ، جارسيا ، جي جي ، باتون ، بي ، تاران ، آر ، ليندلي ، بي ، رينجاردت ، بي ، إلستون ، تي سي ، أند أمب فورست ، جي إم. (2013). نموذج ميكانيكي كيميائي للتنظيم التلقائي لحجم الطبقة السطحية لمجرى الهواء في الرئة. مجلة علم الأحياء النظري. (325) 42-51. PMC3631568 PDF

هونغ ، واي. ، ديفيس ، بي ، مارون ، جي ، كويت ، آر ، وأمبير نيتهامر ، إم (2013). Boxplot الوظيفية المرجحة مع التطبيق على إنشاء الأطلس الإحصائي. جمعية حوسبة الصور الطبية والتدخل بمساعدة الحاسوب. 16 (Pt 3): 584-591. كتاب الفصل PDF

هونغ ، واي. ، نيتهامر ، إم ، أندروجول ، جي ، كيمبيل ، جي ، بيتكين ، إي ، سوبرفاين ، آر ، ديفيس ، إس ، زدانسكي ، سي ، وديفيز ، بي (2013). أطلس مجرى الهواء للأطفال وتطبيقاته في تضيق تحت المزمار. الندوة الدولية حول التصوير الطبي الحيوي: من النانو إلى الماكرو. بي دي إف

هورويتز ، إي ، رحمن ، س. ، باور ، ب ، ديسموك ، د. التوصيف الفيزيائي الحيوي والتركيبي للغاية لفك القفيصة الفيروسية المرتبطة بالغشاء وإطلاق الجينوم. مجلة علم الفيروسات ، 87 (6): 2994-3002. PMC3592113 PMC3592113 / PDF

Hudson، N.، Ding، F.، Bucay، I.، O & # 8217Brien III، ET، Gorkun، O.، Superfine، R.، Lord، S.، Dokholyan، N.، & amp Falvo، M. (2013) . يكشف الارتداد المرن في أقل من ثانية عن الأصول الجزيئية لميكانيكا ألياف الفبرين. مجلة بيوفيزيائية. 104 (12): 2671-2680. PMC3686331 PDF

Jones، G، Blonder، R.، Gardner، G.، Alve، V.، Falvo، M.، & amp Chevrier، J. المجلة الدولية لتعليم العلوم. عبر الانترنت. & # 8220 غير مدعوم من المعاهد الوطنية للصحة & # 8221

كوهلي إل ، ويتون ، إم ، وبروكس ، إف (2013). اللمس المعاد توجيهه: التدريب والتكيف في Warped Virtual Spaced. وقائع ندوة IEEE 2013 حول واجهات المستخدم ثلاثية الأبعاد 3DUI.79-86. بي دي إف

ميتران ، س. (2013). نموذج مستمر-حركي-مجهري لتخليص الرئة بسبب احتجاز السائل الحلقي الأساسي. مجلة الفيزياء الحاسوبية. (244): 193-211.PMC3665523 PDF

نيثامر ، م ، وزاك ، سي (2013). تجزئة مع قيود المنطقة. تحليل الصورة الطبية ، 17 (1): 101-112. PMC3656501 PMC3656501 / PDF

Oldenburg، A.، Chhetri، R.، Cooper، J.، Wu، W.، Troeste، M.، & amp Tracy، J. (2013) nanorods داخل مزارع الأنسجة ثلاثية الأبعاد. رسائل البصريات. 38 (15): 2923-2926. PMC3856705 PDF

Qian، X.، Song، J.M.، Melkamu، T.، Upadhyaya، P.، & amp Kassie، F. (2013) Chemoprevention of the Sandorigenesis by intranasally intranolylmethane in A / J mice. التسرطن. 34 (4): 841-849. PMC3616664 PDF

سامسون تي ، فان بول ، جيه ، دروون ، جيه ، ويلش ، سي ، باكر ، إي ، ماتلونج ، إتش ، فان دن بيرج ، تي ، شارك ، إل ، دورشوك ، سي ، هان ، ك. ، & amp Burridge، K. (2013). يلعب عامل تبادل الغوانين والنيوكليوتيدات SGEF دورًا حاسمًا في تكوين تصلب الشرايين. بلوس واحد. 8 (1): 55202. PMC3555862. بي دي إف

ستيفنس ، إيه ، هاغيرتي ، آر ، فاسكيز ، بي ، فيشي ، إل ، سنايدر ، سي ، شي ، إف ، كوامين ، سي ، مولينز ، سي ، هاس ، جي ، تايلور الثاني ، آر. ، Verdaasdonk، J.، Falvo، M.، Jin، Y. Forest، G.، & amp Bloom، K. (2013). وظيفة حلقات الكروماتين اللامركزية بمثابة زنبرك غير خطي في توازن القوة الانقسامية. مجلة بيولوجيا الخلية. 200 (6): 757-772. PMC3601350 PMC3601350 / PDF

ستيفنس أ ، سنايدر ، سي ، هاس ، جيه ، هاجرتي ، آر ، فاسكيز ، بي ، فورست ، إم ، آند بلوم ، ك. (2013). تعرض pericentromeres الفردية حركة منسقة وتمتد في مغزل الخميرة. مجلة بيولوجيا الخلية. 203 (3): 407-16. PMC3824013 PDF

ستيفنس أ ، كوامين ، سي ، تشانج ، بي ، هاس ، جيه ، تايلور ، آر ، أند بلوم ، ك. (2013). الفصل المكاني من cohesin pericentric و condensin في المغزل الانقسامي. البيولوجيا الجزيئية للخلية. 24 (24): 3909-19. PMC3861086 PDF

تولبرت سي ، بوريدج ، ك ، & أمبير كامبل ، س. (2013). تنظيم فينكولين لتشكيل حزمة F-actin: ماذا يعني ذلك بالنسبة للخلية؟ التصاق الخلية وترحيل أمبير. 7 (2): 219-25. PMC3954036. بي دي إف

تراتر ، ت. ، جونز ، إم ، & أمبير فالفو ، إم. (2013). علم النانو للجميع: استراتيجيات لتدريس علم النانو للطلاب الجامعيين الجدد في العلوم والتخصصات غير العلمية. مجلة تعليم النانو. 5 (1): 1-9. & # 8220 غير مدعوم من المعاهد الوطنية للصحة & # 8217

فارشني ، آر كيه ، سونغ ، سي ، ساكسينا ، آر كيه ، عزام ، إس ، يو ، إس ، شارب ، إيه جي ، كانون ، إس ، بايك ، جي ، روزين ، بي دي ، تار & # 8217an ، B. ، ميلان ، T. ، Zhang ، X. ، Ramsay ، LD ، Iwata ، A. ، Wang ، Y. ، Nelson ، W. ، Farmer ، AD ، Gaur ، PM ، Soderlund ، C. ، Penmetsa ، RV ، Xu ، C. ، Bharti ، AK، He، W.، Winter، P.، Zhao، S.، Hane، JK، Carrasquilla-Garcia، N.، Condie، JA، Upadhyaya، HD، Luo، MC، Thudi، M.، Gowda، CL، سينغ ، NP ، Lichtenzveig ، J. ، Gali ، KK ، Rubino ، J. ، Nadarajan ، N. ، Dolezel ، J. ، Bansal ، KC ، Xu ، X. ، Edwards ، D. ، Zhang ، G. ، Kahl ، G .، Gil، J.، Sing، KB، Datta، SK، Jackson، SA، Wang، J.، & amp Cook، DR (2013) مشروع تسلسل الجينوم للحمص (Cicer arietinum) يوفر موردًا لتحسين السمات. التكنولوجيا الحيوية الوطنية. 31 (3): 240-246. بي دي إف

Vasquez، P.، Jin، Y.، Yuong، K.، Hill، DB، & amp Forest، G. (2013). تطور جديد في مشكلة ستوكس الثانية: الاختراق الجزئي للخطية في الطبقات اللزجة المرنة المنفصمة. مجلة ميكانيكا الموائع غير النيوتونية .196 (0): 36-50. بي دي إف

Verdaasdonk J، Vasquez، P.، Barry، R.، Barry، T.، Goodwin، S.، Forest، M.، & amp Bloom، K. (2013). ربط Centromere يقيد مجالات الكروموسوم. الخلية الجزيئية. 52 (6): 819-31. PMC3877211 PDF

Verdaasdonk J و Stephens و A. و Haase و J. و Bloom K. (2013). ثني القواعد: Widefield Microscopy و Abbe Limit of Resolution Journal of Cellular Physiology. 229 (2): 132-8. PMC4076117. بي دي إف

Wijesundara ، K. ، Iftimia ، N. ، & amp Oldenburg ، A. (2013). تصميم نظام OCT التشريحي ذو المصدر المسحوب لتنظير القصبات للأطفال. وقائع SPIE. 8571. دوى: 10.1117 / 12.2004226. PMC3864962 PDF

Alabi و O. و Wu و X. و Harter و J. و Phadke و M. و Pinto L. و Petersen و H. Bass و S. و Keifer و M. و Zhong و S. و Healey و C. و Taylor II ، R. التصور المقارن للمجموعات باستخدام تشريح أسطح المجموعات. وقائع تصور SPIE وتحليل البيانات 2012 يناير 2012 Burlingame ، كاليفورنيا 8294: 82940U. PMC3614370 PMC3614370 / PDF

Button ، B. ، Cai ، L.H. ، Ehre ، C. ، Kesimer ، M. ، Hill ، DB ، Sheehan ، J. ، Boucher ، R. ، and Rubinstein ، M. (2012). تعمل الفرشاة الحولية على تعزيز صحة الرئة عن طريق فصل الطبقة المخاطية عن ظهارة مجرى الهواء. العلوم 337 (6097): 937-941. PMC3633213 PMC3633213 / PDF

Camassa ، R. ، Forest ، MG ، Lee ، L. ، Ogrosky ، HR ، Olander ، J. (2012). الموجات الحلقية كآلية نقل جماعي في التدفقات الحلقية الأساسية المدفوعة بالهواء. مراجعة جسدية. هـ ، فيزياء المواد الإحصائية وغير الخطية والمادة اللينة. 86 (6 نقاط 2) PDF

Cao، T.، Zach، C.، Modla، S.، Powell، D.، Czymmek، K.، and Niethammer، M. (2012). التسجيل في الفحص المجهري المترابط باستخدام مقارنات الصور. تسجيل الصور الطبية الحيوية (WBIR) .7359: 296-306 NIHMS596525 PDF

Chhetri، R.، Phillips، Z.، Torester، M.، & amp Oldenburg، A. (2012) دراسة طولية للثقافات المشتركة بين الخلايا الظهارية والأرومة الليفية باستخدام التصوير المقطعي بالتماس البصري تكشف عن السمات المورفولوجية لما قبل الورم الخبيث. بلوس واحد. 7 (11): e49148. PMC3495770 PMC3495770 / PDF

كولينز ، سي ، جيلوي ، سي ، ويلش ، سي ، أو & # 8217 براين ، تي ، هان ، ك ، سوبرفاين ، آر ، بوريدج ، ك ، وتزيما إي (2012). تثير قوى التوتر الموضعية على PECAM-1 استجابة نقل ميكانيكي عالمية عبر مسار Integin-RhoA. علم الأحياء الحالي ، 22 (22): 2087-2094. PMC3681294 PDF

Csapo ، I. ، Davis ، B. ، Shi ، Y. ، Sanchez ، M. ، Styner ، M. ، Niethammer ، M. (2012). تسجيل الصورة الطولية مع تغيير المظهر غير الموحد. حوسبة الصور الطبية والتدخل بمساعدة الحاسوب (MICCAI). 15 (جزء 3): 280 - 288. PMC3584325 PMC3584325 / PDF

ديدييه جي ، ماكينلي ، إس ، هيل ، دي بي ، وأمبير فريكس ، ج. (2012). التحديات الإحصائية في علم الأحياء الدقيقة. مجلة تحليل السلاسل الزمنية. 33 (5): 724-43. بي دي إف

Evans، B.، Fiser، B.، Prins، W.، Rapp، D.، Shields، A.، Glass، D.، and Superfine، R. (2012). مادة مرنة مغنطيسية تعتمد على السيليكون قابلة للضبط بدرجة عالية مع تجانس نانوي. مجلة المغناطيسية والمواد المغناطيسية 324 (4): 501-507. PMC3241051 PMC3241051 / PDF

Grooman ، B. ، Fujiwara ، I. ، Otey ، C. ، Upadhyaya ، A. (2012) مورفولوجيا ومرونة اللزوجة لشبكات الأكتين المتكونة من الروابط المتشابكة المتفاعلة: بالادين وألفا أكتينين. بلوس واحد. 7 (8): e42773. PMC3420904 PMC3420904 / PDF

هاس ، ج ، ستيفنز ، أ ، فيرداسدونك ، جيه ، ييه ، إي ، وبلوم ، ك. (2012). يعدل Bub1 Kinase و Sgo1 الكروماتين المحيطي استجابةً لديناميكيات الأنابيب الدقيقة المتغيرة. علم الأحياء الحالي .22 (6): 471-481.PMC3311747 PMC3311747 / PDF

Harter J، Wu، X.، Alabi، O.، Phadke، M.، Pinto، L.، Dougherty، D.، Petersen، H.، Bass، S.، & amp Taylor II، R. المؤامرات الإحداثية المتوازية. وقائع تصور SPIE وتحليل البيانات يناير 2012 Burlingame ، كاليفورنيا 8294: T1 & # 8211 T12.PMC3491905 PMC3491905 / PDF

هونغ ، واي. ، جوشي ، س ، سانشيز ، إم ، ستينر ، إم ، نيتهامر ، إم. (2012). الانحدار الجيوديسي المتحول. حوسبة الصور الطبية والتدخل بمساعدة الحاسوب (MICCAI) 15 (نقطة 3): 197-205. PMC3584322 PMC3584322 / PDF

هونغ ، واي ، شي ، واي ، ستينر ، إم ، سانشيز ، إم ، ونيثامر ، إم (2012). الانحدار الجيوديسي البسيط للسلسلة الزمنية للصور. تسجيل الصور الطبية الحيوية (WBIR) 7359: 11-20. NIHMS596520 PDF

جيرالد ج ، ويتون ، م ، وبروكس ، ف. (2012). عتبات حركة المشهد أثناء انعراج الرأس للبيئات الافتراضية الغامرة. معاملات ACM على الإدراك التطبيقي. 9 (1). PMC4334481 PDF

كالموف ، ب ، ميلر ، ج.ه. ، ميتران ، س ، وتريبوتيتش ، د. (2012). حساب تدفق قضيب حبة اللزجة المرنة بوساطة مقياس حركي متجانس مع قيود شاملة. المحاكاة الجزيئية ، 38 (10): 786-792

Kesimer ، M. ، Ehre ، C. ، Burns ، K.A ، Davis CW ، Sheehan ، J.K. ، Pickles ، R.J. (2012). التنظيم الجزيئي للميوسين والمخاط الغليوكليكس الكامن وراءه ينتقل عبر الأسطح المخاطية للممرات الهوائية. المناعة المخاطية ، 6 (2): 379-392. PMC3637662 PMC3637662 / PDF

كوهلي إل ، ويتون ، إم ، وبروكس ، إف (2012). اللمس المعاد توجيهه: تأثير تواء الفراغ على أداء المهمة. واجهات المستخدم ثلاثية الأبعاد (3DUI) ، مكتبة IEEE Xplore الرقمية 105-12. بي دي إف

Lam Hui ، K. ، Wang ، C. ، Grooman ، B. ، Wayt ، J. ، & amp Upadhyaya ، A. (2012) ترتبط ديناميكيات الغشاء بتكوين مجموعات الإشارات أثناء انتشار الخلية. مجلة بيوفيزيائية. 102 (7): 1524-1533. PMC 3318117 PMC3318117 / PDF

لي ، هـ. ، فوسكي ، إم ، نيثامر ، إم ، كراجسيفسكي ، بي ، & أمبير لين ، إم. (2012). تقدير مشترك قائم على المحاكاة لتشوه الجسم ومعلمات المرونة لتحليل الصورة الطبية. معاملات IEEE على التصوير الطبي. 31 (11): 2156-2168. NIHMS555789 PDF

ليسي ، إي ، جويلوي ، سي ، وبوريدج ، ك. (2012). من القوة الميكانيكية لتنشيط RhoA. الكيمياء الحيوية 51 (38): 7420-7432.PMC3567302 PMC3567302 / PDF

Lewek ، M. ، Feasel ، J. ، Wentz ، E. ، Brooks Jr ، F. ، and Whitton ، M. (2012). استخدام التغذية الراجعة المرئية والاستعدادية لتحسين سرعة المشي والتناظر الزماني المكاني بعد السكتة الدماغية المزمنة: سلسلة الحالات. العلاج الطبيعي 92 (5): 748-756. PMC3345339 PMC3345339 / PDF

ليندلي ، بي ، فورست ، إم جي ، سميث ، بي ، ميتران ، إس ، وهيل ، دي (2012). توزيعات الإجهاد والانفعال المكاني للطبقات اللزجة المرنة في القص التذبذب. الرياضيات والحواسيب في المحاكاة ، 82 (7): 1249-1257.PMC3338131 PMC3338131 / PDF

Liu، C.، Miller، H.، Orlowski، G.، Hang، H.، Upadhyaya، A.، & amp Song، W. (2012) يلزم إعادة تنظيم الأكتين لتشكيل إشارات مستقبلات الخلايا B المستقطبة استجابة لكليهما مستضدات قابلة للذوبان والمرتبطة بالغشاء. مجلة علم المناعة. 188 (7): 3237-3246. PMC3312033 PMC3312033 / PDF

Liu، C.، Miller، H.، Sharma، S.، Beaven، A.، Upadhyaya، A.، & amp Song، W. (2012) تحليل ديناميات الأكتين أثناء تنشيط مستقبل الخلية B في الخلايا B الحية. الكيمياء الحيوية والبيوفيزيائية تبحث في الاتصالات. 427 (1): 202-206. PMC3499104 PMC3499104 / PDF

Miedema، J.، Marron، J. S.، Niethammer، M.، Boland، D.، Woosley، J.، Coposky، J.، Wei، S.، Reisner، H.، and Thomas، N.E (2012). الصورة والتحليل الإحصائي لأنسجة الخلايا الصباغية. علم أمراض الأنسجة .61 (3): 436-444.PMC3425719 PMC3425719 / PDF

أولدنبورغ ، أ ، شيتري ، ر. ، هيل ، دي بي ، وأمبير باتون ، ب. (2012). مراقبة تدفق مخاط مجرى الهواء والنشاط الهدبي باستخدام التصوير المقطعي البصري 3 (9): 1978-1992 .PMC3447542 PMC3447542 / PDF

بيك تي ، فوكس ، إتش ، ويتون ، م. (2012). تصميم وتقييم واجهة حركة حقيقية للمشي على نطاق واسع. معاملات IEEE على التصور ورسومات الكمبيوتر. 18 (7): 1053-67. PMC4091684 PDF

Park، R.، Ping، L.، Song، J.، Hong، S.Y.، Choi، T.Y.، Choi، J.R.، Gorkun، O.V.، and Lord، S. (2012). بقايا الفيبرينوجين γAla341 ضرورية لربط الكالسيوم والتفاعلات & # 8216A-a & # 8217. مجلة التخثر والتخثر 107 (5): 875-883

Phadke، M.، Pinto، L.، Alabi، F.، Harter، J.، Taylor II، R.، Wu، X.، Petersen، H.، Bass، S.، and Healey، C. Exploring Ensemble Visualization. وقائع تصور SPIE وتحليل البيانات 2012 يناير 2012 Burlingame ، كاليفورنيا 8294: (82940B). PMC3278305 PMC3278305 / PDF

Roh-Johnson، M.، Shemer، G.، Higgins، CD، McClellan، JH، Werts، AD، Tulu، US، Gao، L.، Betzig، E.، Kiehart، DP، and Goldstein، B. (2012) .إحداث تغيير في شكل الخلية عن طريق استغلال تقلصات الأكتوميوسين الموجودة مسبقًا. العلوم 335 (6073): 1232-1235.PMC3298882 PMC3298882

تايلور الثاني ، آر ، وبلوم ، ك.؟ الفنون المتقاطعة ورسومات الكمبيوتر؟ في الاستراتيجيات المرئية بقلم فيليس فرانكل وأنجيلا إتش ديبيس: ISBN 978-0-300-17644 2012. ص. 102-107. فصل في الكتاب

Cai، L.H.، Panyukov، S.، and Rubinstein، M. (2011) تنقل الجسيمات النانوية غير اللاصقة في سوائل البوليمر. الجزيئات الكبيرة. 44 (19): 7853-7863 PDF

كابلان ، ج. ، نيتهامر ، إم ، تايلور الثاني آر ، وتشيميك ، ك. (2011). قوة الفحص المجهري المترابط: متعدد الوسائط ، متعدد المقاييس ، متعدد الأبعاد. الرأي الحالي في علم الأحياء الإنشائي ، 21 (5): 686-693. PMC3189301 PMC3189301 / PDF

Eastwood، B.، Mair، L.، and Taylor II، R. (2011). طريقة الإضاءة الهيكلية لتتبع مرحلة المجهر. المؤتمر الدولي حول معالجة الصور والرؤية الحاسوبية والتعرف على الأنماط. 1: 201-207. NIHMS325150 PDF "غير مستثنى من PMC"

إيفانز ب. Superfine R. (2011). اعتبارات تصميم الأهداب التي تعمل مغناطيسيًا. التطبيقات القائمة على المحاكاة الحيوية (ص 473-498). آن جورج (محرر) ، رييكا ، كرواتيا: InTech. كتاب الفصل PDF

Feasel، J.، Whitton، M.، Kassler، L.، Brooks، F.، and Lewek، M. النظام المتكامل لإعادة تأهيل البيئة الافتراضية. معاملات IEEE على الأنظمة العصبية وهندسة إعادة التأهيل 2011.19 (3): 290-297. بي دي إف

Finan، J.D.، Leddy، H.A، & amp Guilak، F. (2011) الإجهاد التناضحي يغير تكاثف الكروماتين ونقل النواة. الكيمياء الحيوية والبيوفيزيائية تبحث في الاتصالات. 408 (2): 230-235. PMC3104296 PMC3104296 / PDF

Fronczek، D.، Quammen، C.، Wang، H.، Kisker، C.، Superfine، R.، Taylor II، R.، Erie، D.، Tessmer، I. (2011). التصوير الهجين Fiona-AFM عالي الدقة. التنظير الفائق .111 (5): 350-355. PMC3179268 PMC3179268 / PDF

جيبس فلورنوي ، إي ، برومبيرج ، بي ، هوفر ، تي ، ساميت ، جيه ، وأمب زوكر ، ر. (2011) الكشف المجهري داركفيلد متحد البؤر لاستيعاب الجسيمات النانوية بواسطة خلايا الرئة البشرية. علم السموم الجسيمات والألياف. 8: 2. PMC3033333 PMC3033333 / PDF

Guilluy C.، Swaminathan، V.، Garcia-Mata R.، O & # 8217Brien، E.، Superfine، R.، Burridge K. (2011). تنظم Rho GEFs LARG و GEF-H1 الاستجابة الميكانيكية للقوة على الإنتجرينات. بيولوجيا خلية الطبيعة. 2011 13 يونيو (6): 724-729. PMC3107386 PMC3107386 / PDF

Guilluy، C.، Garcia، -Mata، R.، & amp Burridge، K. (2011) Rho protein crosstalk: شبكة اجتماعية أخرى؟ الاتجاهات في بيولوجيا الخلية. 21 (12): 718-726. PMC3221770 PMC3221770 / PDF

Lewis، J.، Hembree، W.، Furman، B.، Tippets، L.، Cattel، D.، Huebner، J.، Little، D.، & amp DeFrate، L. (2011) أمراض المفاصل الحادة والالتهاب الزليلي هو يرتبط بزيادة شدة الكسر داخل المفصل في ركبة الفأر. هشاشة العظام والغضاريف. 19 (7): 864-873. PMC3312469 PMC3312469 / PDF

Liu، C.، Miller، H.، Hui، KL، Grooman، B.، Bolland، S.، Upadhyaya، A.، & amp Song، W. (2011) توازن Bruton & # 8217s tyrosine kinase و SHIP ينظم تنشيط B تشكيل كتلة مستقبلات الخلايا عن طريق التحكم في إعادة تشكيل الأكتين. مجلة علم المناعة. 187 (1): 230-239. PMC3119787 PMC3119787 / PDF

Lozoya O. ، Wauthier E. ، Turner R. ، Barbier C. ، Prestwich G. ، Guilak F. ، Superfine R. ، Lubkin S. ، Reid L. مكانة الخلايا الجذعية للكبد البشري. المواد الحيوية. 32 (30): 7389-7402. PMC3157321. PMC3157321 / PDF

ماير ، إل أوه ، إيفانز ، بي ، هول ، إيه آر ، كاربنتر ، جيه ، شيلدز ، إيه ، فورد ، ك. السباحة بالقرب من السطح التي يمكن التحكم فيها بدرجة عالية من Janus Nanorods المغناطيسية: تطبيق لالتقاط الحمولة الصافية ومعالجتها. مجلة الفيزياء د: الفيزياء التطبيقية. 44 (125001). NIHMS337284 PDF

Merkel، T.، Jones، S.، Herlihy، K.، Kersey، F.، Shields، A.، Napier، M.، Luft، J.، Wu، H.، Zamboni، W.، Wang، A.، Bear، J.، & amp DeSimone، J. (2011). استخدام المحاكاة الميكانيكية الحيوية لخلايا الدم الحمراء لتمديد أوقات دوران جزيئات الهيدروجيل الدقيقة. وقائع الأكاديمية الوطنية للعلوم 108 (2): 586-591. PMC3021010 PMC3021010 / PDF

Mitran، S.، & amp Young، J. (2011). حساب متعدد النطاقات لميكانيكا الهيكل الخلوي أثناء Blebbing. الميكانيكا الخلوية والجزيئية الحيوية وعلم الأحياء الميكانيكية .345-371 PDF

نيتهامر ، إم ، هارت ، جي ، بيس ، دي ، فيسبا ، بي ، إيرييميا ، إيه ، فان هورن ، جيه ، وأيلوارد ، إس. مؤتمر حوسبة الصور الطبية والتدخل بمساعدة الحاسوب 2011.14: 639-646. PMID21995083 PDF

Niethammer، M.، Huang، Y.، Vialard، F.، (2011) 14 (Pt 2): 655-662. PMID21995085 PDF

بيس ، دي ، إنكووباري ، أ ، يانغ ، إتش ، إيلوارد ، إس ، ونيثامر ، إم. الندوة الدولية حول التصوير الطبي الحيوي 2011: 407-413.PMC3141338 PMC3141338 / PDF

Peck، T.، Fuchs، H.، & amp Whitton، M.. وقائع الواقع الافتراضي IEEE من 19 إلى 23 آذار (مارس) 2011 ، سنغافورة: 55-62.PMC3268068 PMC3268068 / PDF

Ping، L. Huang، L.، Cardinali، B.، Profumo، A.، Gorkun، OV، & amp Lord، ST، (2011) يؤدي استبدال منطقة aC البشرية بمجال الدجاج المماثل إلى إنتاج الفيبرينوجين مع ضعف شديد في التجميع الجانبي : مونومرات الفيبرين تتجمع في بروتوفيبريلات لكن اللييفات الأولية لا تتجمع في ألياف. الكيمياء الحيوية. 50 (42 (: 9066-9075. PMC3203410 PMC3203410

Quammen ، C. & amp Taylor II ، R. (2011). تغلق الشبكة مع تأثيرات الحجم الجزئية في VTK. مجلة VTK. مارس. NIHMS325155 & # 8220 غير مستثناة بواسطة PMC & # 8221 PDF

شين ، كيه ، تولبرت ، سي إي ، جيلوي ، سي ، سواميناثان ، في إس ، بيرجينسكي ، إم إي ، بوريدج ، كيه ، سوبرفاين ، آر ، وكامبل ، إس إل. (2011). يتوسط دبوس الشعر Vinculin C-terminal تشكيل حزمة F-actin ، والتصاق بؤري ، وخصائص ميكانيكية للخلية. مجلة الكيمياء البيولوجية. 286 (52): 45103-45115. PMC3247952 PMC3247952 / PDF

Skarbez، R.، Kotranza، A.، Brooks، F.، Lok، B.، and Whitton، M. استكشاف أولي لأخطاء المحادثة كأسلوب جديد لتقييم التجارب البشرية الافتراضية. وقائع الواقع الافتراضي IEEE 2011 مارس 2011 سنغافورة: 243-244 PDF

Spero، R.، Sircar، R.، Shubert، R.، Taylor II، R.، Wolberg، A.، Superfine، R. (2011). يقيس انتشار الجسيمات النانوية نفاذية الجلطة. مجلة بيوفيزيائية. 101 (1-8): 943-950. PMC317506 PMC3175063 / PDF

ستيفنس ، إيه ، هاس ، جيه ، فيشي ، إل ، تايلور الثاني ، آر ، وبلوم ، ك. (2011). ينتج Cohesin و condensin والحلقة المركزية داخل الجزيء معًا نوابض الكروماتين الانقسامية. مجلة بيولوجيا الخلية .193 (7): 1167-1180. PMC3216333 PMC3216333 / PDF

سواميناثان ، ف ، ميثري ، ك. ، أوبراين ، إي ، بيرتشوك ، إيه ، بلوب ، جي ، سوبرفاين ، ر. (2011). يعمل الصلابة الميكانيكية على تصنيف إمكانات النقائل في الخلايا السرطانية للمريض وخطوط الخلايا السرطانية. أبحاث السرطان 71 (15): 5075-5080. PMC3220953 PMC3220953 / PDF

Yemolenko ، I.S. ، Alexander ، F. ، Gorkun ، O.V. ، Lishko ، V.K. ، Lord ، S.T. ، Ros ، R. ، & amp Ugarova ، T.P. (2011) دور مجالات ألفا سي في تكوين مصفوفات الفيبرينوجين غير اللاصقة. دم. 118 (21): 538

Young، J.، & amp Mitran، S. (2011). خوارزمية مجهرية متصلة لنمذجة الوسائط الليفية غير المتجانسة مع الهياكل الدقيقة الديناميكية. نمذجة ومحاكاة SIAM متعددة النطاقات 9 (241-256) PDF

كامبل ، آر ، أليمان ، إم ، جراي ، إل ، فالفو ، إم ، وأم وولبيرج ، إيه (2010). يؤثر التدفق بعمق على بنية شبكة الفبرين: الآثار المترتبة على تكوين الفيبرين واستقرار الجلطة في الإرقاء. مجلة التخثر والتخثر. 104 (6): 1281-1284. PMC3236083 PMC3236083 / PDF

كارلايل ، آر سي ، سباركس ، إي إيه ، دير لوغيان ، سي ، وأمبير جوتهولد ، إم (2010). قوة وفشل نقاط التفرع الليفي. مجلة التخثر والتخثر 8 (5): 1135-1138.PMC3013622 PMC3013622 / PDF

Chehetri، R.، Carpenter، J.، Superfine، R.، Randell، S.، & amp Oldenburg، A. (2010). التصوير الإلستوجرافي البصري للتماسك المغناطيسي الحركي لربط بنية الرئة ووظيفتها في التليف الكيسي. وقائع SPIE. المجلد. 7554. PMC3268340 PMC3268340 / PDF

كريب ، ج. ، ميهان ، ت. ، شاه ، إس ، سكينر ، ك. & أمبير ؛ سوبرفاين ، ر. (2010). الأسطوانات مقابل المجالات: ترقق الموائع الحيوية في نقل الجسيمات النانوية المدفوعة. حوليات الهندسة الطبية الحيوية. 38 (11): 3311-3322. PMC3858002 PMC3858002 / PDF

Falvo ، M. ، Gorkun ، O. ، & amp Lord. س (2010). الأصول الجزيئية للخواص الميكانيكية للفيبرين. الكيمياء الفيزيائية الحيوية. نوفمبر 152 (1-3): 15-20. PMC2975759 PMC2975759 / PDF

Feasel، J.، Whitton، M.، Kassler، L.، Brooks، F.، and Lewek، M. النظام المتكامل لإعادة تأهيل البيئة الافتراضية. معاملات IEEE على الأنظمة العصبية وهندسة إعادة التأهيل 19: 290-297. بي دي إف

Feng ، D. ، Kwock ، L. ، Lee ، Y. ، & amp Taylor II ، R.M (2010). التصورات الاستكشافية المرتبطة لبيانات التحليل الطيفي للرنين المغناطيسي غير المؤكدة. وقائع مؤتمر التصور وتحليل البيانات (SPIE) 7530: 12 صفحة PMC2997734 PMC2997734 / PDF

Feng ، D. ، Lee ، Y. ، Kwock ، L. ، & amp Taylor II ، R. (2010). مطابقة التميز البصري بالثقة في مؤامرات البيانات غير المؤكدة. معاملات IEEE على التصور والرسومات الحاسوبية (تصور الإجراءات / تصور المعلومات). 16 (6): 980-989. PMC3179257 PMC3179257 / PDF

هاكني ، زد ، ماير ، إل ، سكينر ، ك ، واشبورن ، س. (2010). الخصائص الضوئية والاستقطاب للأسلاك النانوية CdTe الفردية. خطابات المواد 64 (18) 2016-2018. PMC2920430 PMC2920430 / PDF

Hall، A.R، An، L.، Liu، J.، Vicci، L.، Falvo، M.R، Superfine، R.، Washburn، S. (2010). قياس تجريبي للخصائص الالتوائية لأنابيب نانوية كربونية أحادية الجدار. خطابات المراجعة المادية 96 (25): 256102. PMC3274556 PMC3274556 / PDF

هارت ، جي ، شي ، واي ، تشو ، إتش ، سانشيز ، إم ، ستينر ، إم ، ونيثامر ، إم (2010). مبنى أطلس DTI الطولي كمتوسط ​​لنماذج النمو. حوسبة الصور الطبية والتدخل بمساعدة الكمبيوتر ، ورشة عمل حول تحليل الصور المكانية والزمانية لبيانات الصور الطولية والمتسلسلة الزمنية. NIHMS337251 PDF

Hill، D.، Swaminathan، V.، Estes، A.، Cribb، J.، O & # 8217Brien، E.، Davis، C.، Boucher، R.، & amp Superfine، R. (2010). توليد القوة وديناميكيات الأهداب الفردية تحت التحميل الخارجي. المجلة الفيزيائية الحيوية 6:98 (1): 57-66. PMC2800978 PMC2800978 / PDF

هوسر ، جيه ، هدسون ، إن ، بينج ، إل ، أوبراين ، إي ، سوبرفاين ، آر ، لورد ، س ، & أمبير فالفو ، إم. (2010). دليل على أن منطقة αC هي أصل معامل منخفض وقابلية تمدد عالية وتصلب في ألياف الفيبرين. مجلة بيوفيزيائية. 99 (9): 3038-3047. PMC2965937 PMC2965937 / PDF

هدسون ، إن ، هاوسر ، جي ، أوبراين ، إي ، تايلور ، آر ، سوبرفاين ، آر ، لورد ، إس ، وأم فالفو ، إم (2010). يؤدي تقوية ألياف الفيبرين الفردية إلى توزيع الضغط بشكل منصف ويقوي الشبكات. مجلة الفيزياء الحيوية 98 (8): 1632-1640. PMC2856168 PMC2856168 / PDF

Kassler ، L. ، Feasel ، J. ، Lewek ، M. ، Brooks ، F. ، & amp Whitton ، M. وقائع ندوة ACM السابعة حول الإدراك التطبيقي في الرسومات والتصور LosAngeles CA: 161-161 PDF

ليو ، إكس ، ديفيس ، ب ، نيثامر ، إم ، بيزر ، إس ، ماجيراس ، جي (2010). تشكيل أطلس الحركة التنفسية المدفوع بالتنبؤ للعلاج الإشعاعي الموجه بالصور رباعي الأبعاد في الرئة. MICCAI ، ورشة عمل دولية حول تحليل الصور الرئوية. NIHMS337269 (لم تقبله PMC) PDF

ليو ، دبليو ، كارلايل ، آر سي ، سباركس ، إي إيه ، وأمبير جوثولد ، إم (2010). الخواص الميكانيكية لألياف الفبرين المفردة. مجلة التخثر والتخثر .8 (5): 1030-1036.PMC3010862 PMC3010862 / PDF

Liu، Y.، Lin، X.، Upadhyaya، M.، Song، Q.، & amp Chen، K. (2010) داخل الأورام المخاطية الحليمية داخل البنكرياس: ارتباط ميزات التصوير المقطعي الحلزوني بالنتائج المرضية. المجلة الأوروبية للأشعة. 76 (2): 222-227 PDF

نيثامر ، إم ، بورلاند ، دي ، مارون ، إس ، ووسلي ، ج ، وتوماس ، إن (2010). تطبيع مظهر شرائح الأنسجة. حوسبة الصور الطبية والتدخل بمساعدة الكمبيوتر ، ورشة عمل حول التعلم الآلي في التصوير الطبي 6357: 58-66. NIHMS337285 PDF

Nunes ، J. ، Herlihy ، K. P. ، Mair ، L.O. ، Superfine ، R. ، & amp DeSimone ، J.M (2010). شكل وحجم متعدد الوظائف جزيئات محددة مغنطيسية بوليمر مركبة. رسائل نانو ، 10 (4): 1113-1119.PMC3357060 PMC3357060 / PDF

بيك ، تي ، فوكس ، إتش ، أمبير ويتون ، إم (2010). إعادة توجيه محسّنة مع عوامل تشتيت الانتباه: نظام تنقل حقيقي واسع النطاق وتأثيره على التنقل في البيئات الافتراضية. وقائع IEEE Virtual Reality 2010 (Waltham ، MA مارس 2010) ، 35-38. بي دي إف

Quammen ، C. & amp Taylor II ، R. (2010). "تكييف إطار تسجيل ITK ليناسب نماذج الصور البارامترية ،" مصدر Kitware. (16): 9-12. PMC3322640 PMC3322640 / PDF

Shields، A. R.، Fiser، B. L.، Evans، BA، Falvo، M.R.، Washburn، S.، & amp Superfine، R. تولد مصفوفات أهداب المحاكاة الحيوية أنظمة ضخ وخلط متزامنة. وقائع الأكاديمية الوطنية للعلوم 7 سبتمبر 2010.107: 15670-15675.PMC2936597 PMC2936597 / PDF

تايلور الثاني ، آر إم ، جيرالد ، جيه ، فاندركنيف ، سي ، ويندت ، جيه ، بورلاند ، دي ، مارشبورن ، دي ، شيرمان ، دبليو آر ، ويتون ، إم سي (2010). دروس حول أنظمة برمجيات البيئة الافتراضية من 20 عامًا من بناء VE. الحضور 19 (2): 163-178. PMC2887604 PMC2887604 / PDF

Wendt ، J. ، Whitton ، M.C ، & amp Brooks ، F.B (2010). GUD WIP: المشي في المكان المدفوع بفهم المشي وقائع IEEE Virtual Reality 2010 (Waltham ، MA March 2010) ، 51-58. NIHMS599421 PDF

Young، J.، & amp Mitran، S. (2010). نموذج رقمي من Blebbing الخلوي. نموذج التفاعل بين هيكل الموائع والمحافظة على الحجم للخلية بأكملها. مجلة الميكانيكا الحيوية. (43): 210-220. PMC2813352 PMC2813352 / PDF

كامبل ، آر إيه ، أوفرمير ، ك.أ ، سيلزمان ، سي إتش ، شيريدان ، بي سي ، وأمبير وولبيرج ، إيه إس (2009). مساهمات الخلايا خارج الأوعية الدموية وداخل الأوعية الدموية في تكوين شبكة الفبرين وهيكلها واستقرارها. Blood: 114 (23): 4886-4896.PMC2786294 PMC2786294 / PDF

كارلايل ، سي آر ، كولايس ، سي ، نامبوتيري ، إم ، كارول ، دي إل ، هانتجان ، آر آر ، وأمبير جوتولد ، إم (2009). الخصائص الميكانيكية لألياف الفيبرينوجين الفردية والمغزولة كهربائيا. المواد الحيوية 30 (6): 1205-1213.PMC3012557 PMC3012557 / PDF

Chourasia، A.، & amp Taylor II، R. IEEE Visualization 2008 Design Contest. IEEE CG & ampA Visualization Viewpoints مايو / يونيو 2009.29: pp. 86-87

دارلينج ، إي إم ، بي إي بريتشيت ، إيفانز ، بي ، سوبرفاين ، آر ، زوشر ، إس ، آند جويلاك ، إف (2009). الخواص الميكانيكية والتعبير الجيني للخلايا الغضروفية على ركائز متناهية الصغر بعد التمايز في أحادي الطبقة. الهندسة الحيوية الخلوية والجزيئية 2 (3): 395-404. PMC2898162 PMC2898162 / PDF

Dedeugd، C.، Wankhede، M.، & amp Sorg، B. S. (2009). التصوير البصري متعدد الوسائط لديناميكيات نقل الأكسجين بالحمل الحراري لشبكة الأوعية الدقيقة. البصريات التطبيقية ، 48 (10): D187-197. بي دي إف

Feng ، D. ، Kwock ، L. ، Lee ، Y. Z. ، & amp Taylor ، R.M (2009). تقييم تقنيات تصور الحجم متعدد المتغيرات المستندة إلى الحروف الرسومية. وقائع الندوة السادسة حول الإدراك التطبيقي في الرسومات والتصور 2009: 61-68. PMC3087293 PMC3087293 / PDF

فيشر ، ج.ك. ، بالينجر ، إم ، أو & # 8217 براين ، إي تي ، هاس ، جيه ، سوبرفاين ، آر ، آند بلوم ، ك. (2009). ديناميات استرخاء الحمض النووي كمسبار للبيئة داخل الخلايا. وقائع الأكاديمية الوطنية للعلوم 106 (23): 9250-9255. PMC2695107 PMC2695107 / PDF

Fricks ، J. ، Yao ، L.X. ، Elston ، T.C ، & amp Forest ، M.G (2009). طرق المجال الزمني للنقل المنتشر في المواد الناعمة. مجلة SIAM للرياضيات التطبيقية ، 69 (5): 1277-1308 PDF

جيراردين ، إي ، شيتيلات ، جي ، تشوبين ، إم ، كووينجنيت ، آر ، ديسجرانج ، بي ، كيم ، إتش إس ، نيثامر ، إم ، دوبوا ، بي ، ليهيريسي ، إس ، غارنيرو ، إل ، يوستاش ، F. ، Colliot ، O. ، Alzheimer & # 8217s Dis Neuroimaging ، I. (2009). التصنيف متعدد الأبعاد لخصائص شكل الحصين يميز مرض الزهايمر والضعف الإدراكي المعتدل من الشيخوخة الطبيعية. Neuroimage.47 (4): 1476-1486.PMC3001345 PMC3001345 / PDF

Ghosh، S.، Dutta، S.، Gomes، E.، Carroll، D.، D & # 8217Agostino Jr.، R.، Olson، J.، Guthold، M.، & amp Gmeiner، W.H. (2009). زيادة كفاءة التسخين والاستئصال الحراري الانتقائي للأنسجة الخبيثة باستخدام الأنابيب النانوية الكربونية متعددة الجدران المغلفة بالحمض النووي. ACS Nano.3 (9): 2667-2673 .PMC2748720 PMC2748720 / PDF

جروب ، بي آر ، روجرز ، تي دي ، باوتشر ، آر سي ، وأمب أوستروسكي ، إل إي (2009). نقل الأيونات عبر التليف الكيسي والظهارة الطبيعية الشمية والفئران الهدبية. المجلة الأمريكية لعلم وظائف الأعضاء # 8211 فسيولوجيا الخلية. 296 (6): C1301-C1309.PMC2692423 PMC2692423 / PDF

Hinczewski، M.، Schlagberger، X.، Rubinstein، M.، Krichevsky، O.، Netz، R. R. (2009). ديناميات نهاية مونومر في البوليمرات شبه المرنة. الجزيئات الكبيرة 42 (3): 860-875.PMC3043606 PMC3043606 / PDF

جيرالد ، ج. ، ستينيك ، إف ، وأمبير ويتون ، دبليو. تقدم IEEE في التفاعل بين الكمبيوتر والإنسان 2009: 69-75 PDF

جيرالد ، ج. ، وأمبير ويتون ، م. (2009). ربط حدود المشهد والحركة بحدود الكمون للشاشات المثبتة على الرأس. وقائع IEEE Virtual Reality Lafayette ، LA. 211-218 مارس. PMC3095496 PMC3095496 / PDF

جيرالد ، ج. المشهد عدم الاستقرار أثناء دوران الرأس. وقائع ورشة عمل IEEE VR حول الأوهام الإدراكية في البيئات الافتراضية 2009 لافاييت ، LA PDF

كابلان ، إي ، مين ، جي واي ، كي ، كيو ، تشين ، واي ، نيثامر ، إم ، رانا ، جي إس ، مالك ، إس ، فيرهوغت ، إف دبليو إيه ، وأمبير مورجان ، جي بي (2009). يؤثر الكالسيوم والنيوكليوتيدات الحلقية على هجرة الخلايا الجذعية المستحثة بعامل نخر الورم ألفا. اتصالات البحوث البيوكيميائية والفيزيائية الحيوية 382: 241-246.PMC2941773 PMC2941773

كوهلي ، ل.استغلال الأوهام الإدراكية لتعزيز اللمسات السلبية. ورشة عمل IEEE VR حول الأوهام الإدراكية في البيئات الافتراضية 2009 Lafayette، LA PDF

Levitt، JJ، Styner، M.، Niethammer، M.، Bouix، S.، Koo، MS، Voglmaier، MM، Dickey، CC، Niznikiewicz، MA، Kikinis، R.، McCarley، RW، Shenton، ME (2009) . تشوهات شكل النواة المذنبة في اضطراب الشخصية الفصامية.أبحاث الفصام 110 (1-3): 127-139.PMC2756791 PMC2756791 / PDF

Lindley، B.، Howell، E.L، Smith، B. D.، Rubinstein، G.J، Forest، M.G، Mitran، S.M، Hill، D.B، & amp Superfine، R. (2009). تواصل الإجهاد وترشيح الطبقات اللزجة المرنة في القص التذبذب. مجلة ميكانيكا الموائع غير النيوتونية 156 (1-2): 112-120. بي دي إف

ليفراغي ، إيه ، جروب ، بي آر ، هدسون ، إي جيه ، ويلكينسون ، كيه جيه ، شيهان ، جيه كيه ، مول ، إم إيه ، أو & # 8217 نيل ، دبليو كيه ، باوتشر ، آر سي ، وأمبير رانديل ، إس إتش (2009). أمراض مجرى الهواء والرئة بسبب جفاف سطح الغشاء المخاطي في الفئران الظهارية Na + overexpressing القناة: دور TNF- و IL-4R الإشارات ، وتأثير تطور الأطفال حديثي الولادة ، والفعالية المحدودة للعلاج بالجلوكوكورتيكويد. مجلة علم المناعة. 182 (7): 4357-4367. PMC2659461 PMC2659461 / PDF

Macenko، M.، Niethammer، M.، Marron، J. S.، Borland، D.، Woosley، J. T.، Guan، X.، Schmitt، C.، & amp Thomas، N.E (2009). طريقة لتطبيع شرائح الأنسجة للتحليل الكمي. الندوة الدولية حول التصوير الطبي الحيوي 1107-1110

ماير ، إل ، فورد ، ك ، ألم ، آر ، كول ، آر ، فيشر ، إم ، & أمبير سوبرفاين ، ر. (2009). الحجم الموحد للجسيمات 200 نانومتر: التصنيع والتطبيق على العدسة المغناطيسية. مجلة تقنية النانو الطبية الحيوية 5: 182-191. PMC2818021 PMC2818021 / PDF

ماير ، إل ، سكينر ، ك ، دونلي ، سي إل ، سوبرفاين ، ر. (2009). الأسلاك النانوية Au-CdTe-Au المودعة كهربائياً: التحكم القائم على المحلول في قياس العناصر المتكافئة في الكادميوم والكادميوم. معاملات المجتمع الكهروكيميائية (19 (3)): 99-109.

McKinley، S.، Yao، L.، & amp Forest، M. (2009). انتشار شاذ عابر لجزيئات التتبع في المادة اللينة. مجلة الريولوجيا. (53): 1487-1506 PDF

Niethammer، M.، Zach، C.، Melonakos، J.، Tannenbaum، A. (2009). تجزئة حزمة الألياف الأنبوبية القريبة من أجل التصوير الموزون بالانتشار: التجزئة من خلال إعادة توجيه الإطار. Neuroimage.45 (1): S123-S132.PMC2774769 PMC2774769 / PDF

بيك ، تي إم ، فوكس ، إتش ، أمبير ويتون ، إم سي (2009). تقييم تقنيات إعادة التوجيه والمشتتات للمشي في البيئات الافتراضية الكبيرة. معاملات التصور والرسومات الحاسوبية 15 (3): 383-394. PMC2844119 PMC2844119 / PDF

بيك ، تي ، فوكس ، إتش ، أمبير ويتون ، إم سي (2009). إعادة توجيه محسّنة مع عوامل تشتيت الانتباه: نظام تنقل حقيقي واسع النطاق وتأثيره على التنقل في البيئات الافتراضية. مؤتمر الواقع الافتراضي (VR) IEEE.35-38 PDF

Quammen، C.، Feng، D.، & amp Taylor II، R.M. أداء خوارزميات التفكيك ثلاثية الأبعاد على معماريات متعددة النواة ومتعددة النوى. التقرير الفني لقسم علوم الكمبيوتر التابع لجامعة الأمم المتحدة في تشابل هيل. TR-09-001 PDF

Reuter ، M. ، Wolter ، F. E. ، Shenton ، M. ، Niethammer ، M. (2009). القيم الذاتية لابلاس-بلترامي والميزات الطوبولوجية للوظائف الذاتية لتحليل الشكل الإحصائي. التصميم بمساعدة الكمبيوتر 41 (10): 739-755.PMC2753296 PMC2753296 / PDF

Taylor II، RM، Robinett، W.، Chi، VL، Brooks Jr.، FP، Wright، WV، Williams، RS، Snyder، RJ، Chen، J.، Okimoto، S.، Llopis-Artime، N.، Falvo ، M.، Paulson، S.، Thiansathaporn، P.، Glick، D.، Washburn، S.، Superfine، R.، Jen، D.، Parente، P.، Robbins، J.، Weigle، C.، Burette ، A. ، Weinberg ، R. ، Varadhan ، G. ، & amp Erie ، D. أنظمة الكمبيوتر المتكاملة للفحص المجهري والمعالجة. معرض IEEE VisWeek 2009 Discovery 2009: صفحتان PDF

فوينسكوس ، AN ، O & # 8217Donnell ، LJ ، Lobaugh ، NJ ، Markant ، D. ، Ameis ، SH ، Niethammer ، M. ، Mulsant ، BH ، Pollock ، BG ، Kennedy ، JL ، Westin ، CF ، Shenton ، ME (2009) . الفحص الكمي لطريقة التجميع الجديدة باستخدام التصوير بالرنين المغناطيسي. Neuroimage.45 (2): 370-376.PMC2646811 PMC2646811 / PDF

Wirtz، D. (2009) علم الأحياء الدقيقة لتتبع الجسيمات للخلايا الحية: المبادئ والتطبيقات. المراجعة السنوية للفيزياء الحيوية. 38: 301-326 PDF

زاك ، سي ، نيتهامر ، إم ، وأمبير فراهم ، جي إم (2009). التدفقات القصوى المستمرة وأشكال Wulff: تطبيقات على MRFs. وقائع المؤتمر حول رؤية الكمبيوتر والتعرف على الأنماط (CVPR) .1911-1918 PDF

زاك ، سي ، شان ، إل ، وأمبير نيثامر ، إم (2009). ملامح Finsler النشطة المثالية عالميًا. وقائع ندوة التعرف على الأنماط للجمعية الألمانية للتعرف على الأنماط (DAGM) 5748: 552-561 PDF

Zhang L، B. B.، Gabriel SE، Burkett S، Yan Y، Skiadopoulos MH، Dang YL، Vogel LN، McKay T، Mengos A، Boucher RC، Collins PL، Pickles RJ. (2009). يعيد توصيل CFTR إلى 25٪ من الخلايا الظهارية السطحية المعدلات الطبيعية لانتقال المخاط إلى التليف الكيسي البشري الظهارة. علم الأحياء بلوس. (7) PMC2705187 PMC2705187 / PDF

بوتون ، ب. ، باوتشر ، آر سي (2008). دور الإجهاد الميكانيكي في تنظيم ترطيب سطح مجرى الهواء ومعدلات إزالة المخاط. Respir Physiol Neurobiol.163 (1-3): 189-201. PMC2645865

Cakici، SS Sezerman، U.، & amp Balcisoy، S. (2008) DockPro: أداة قائمة على VR لمشكلات إرساء البروتين والبروتين. المجلة الدولية للواقع الافتراضي. 8 (العدد 2-2009 / 4): 19-23.

كامبل ، R.A. ، Overmyer ، K.A. ، Bagnell ، C.R. ، & amp Wolberg ، A.S. (2008) نشاط محفز التخثر الخلوي يملي بنية الجلطة واستقرارها كدالة على المسافة من سطح الخلية. تصلب الشرايين والجلطة، وعلم الأحياء الأوعية الدموية. 28 (12): 2247-2254. PMC2773697
المنشور PMC2773697

ديفيس ، سي دبليو ، وأمبير لازاروفسكي ، إي (2008). اقتران النشاط الهدبي في مجرى الهواء وإفراز الميوسين بالضغوط الميكانيكية عن طريق إشارات البيورينج. علم وظائف الجهاز التنفسي علم الأعصاب. (163): 1-3. PMC2583098

Davis، C.W.، & amp Dickey، B.F. (2008) تنظيم إفراز خلية مجرى الهواء الكأس. المراجعة السنوية لعلم وظائف الأعضاء. 70: 487-512.
نشر 17988208

Desai، KV، Bishop، TG، Vicci، L.، O & # 8217Brien، ET، Taylor II، R.، & amp Superfine، R. (2008) تتبع الجسيمات اللاأدري للحركة ثلاثية الأبعاد للحبيبات الخلوية وديناميات الخرزة المربوطة بالغشاء . مجلة بيوفيزيائية. 94(6): ص. 2374-84. PMC2257905

Desprat، N.، Supatto، W.، Pouille، PA، Beaurepaire، E.، & amp Farge، E. (2008) يُعدِّل تشوه الأنسجة التعبير الملتوي لتحديد تمايز المعى المتوسط ​​الأمامي في أجنة ذبابة الفاكهة. الخلية التنموية. 15 (3): 470-477.

Falvo، M.R.، Millard، D.، O & # 8217Brien، ET، Superfine، R.، & amp Lord، S. (2008) يرتبط طول التكرار الترادفي في منطقة الفايبرين & # 8217s alphaC بإمكانية تمدد الألياف. مجلة التخثر والتخثر. 2008 PMC2655637

فيسل ، ج. ، م. ويتون وجيه دي ويندت. LLCM-WIP: زمن انتقال منخفض ، حركة مستمرة في المكان. وقائع ندوة IEEE على واجهات المستخدم ثلاثية الأبعاد. 2008. 97-104.

Feng ، D. ، Y. Lee ، L. Kwock ، و Taylor R.M. الثاني. تصور الحجم القياسي متعدد المتغيرات للعلاقة وتقدير القيمة. المعاملات على التصور والرسومات الحاسوبية. 2008.

Hohenegger ، C. ، Forest ، M. (2008). الريولوجيا الدقيقة ثنائية الخرز: بروتوكولات النمذجة. مراجعة جسدية. فيزياء المواد الإحصائية وغير الخطية والمادة اللينة ، 78 (3 نقاط 1): 031501.PMC2692253

Huang، B.، Jones، SA، Brandenburg، B.، & amp Zhuang، X. (2008) تكشف عاصفة ثلاثية الأبعاد للخلية الكاملة عن التفاعلات بين الهياكل الخلوية بدقة مقياس نانومتر. طرق الطبيعة. 5 (12) 1047-1052. PMC2596623
المنشور PMC2596623

جيرالد ، ج. ، ت. بيك ، إف ستاينيك ، وم. ويتون. الحساسية تجاه حركة المشهد لمراحل الداء العليقي للرأس. وقائع الإدراك التطبيقي في الجرافيك والتصور. 2008.

Kharlampieva ، E. ، Ankner ، J.F. ، Rubinstein ، M. ، & amp Sukhishvili ، SA (2008) إطلاق polyanions الناجم عن الأس الهيدروجيني من أفلام متعددة الطبقات. رسائل المراجعة البدنية. 100 (12): 128303

Kreda، S.، Boucher، RC، Lazarowski، E. (2008). إطلاق النوكليوتيدات وعلم وظائف الأعضاء الظهارية للمجرى الهوائي. أخبار علم وظائف الأعضاء. (71): 19-22

Lan ، Y. ، Elston ، T.C. ، & amp Papoian ، G.A. (2008) القضاء على المتغيرات السريعة في معادلات لانجفين الكيميائية. مجلة الفيزياء الكيميائية. 129 (21): 214115. PMC2674792

Lloyd، B.، Govindaraju، N.، Quammen، C.، Molnar، S.، Manocha، D. (2008) Logarithmic Perspective Shadow Maps. معاملات الرسومات لدى ACM. 27 (4)

ميهاليك ، جي بي ، إل كوهلي ، إم سي. ويتون. هل الخصائص الفيزيائية لجهاز الواقع الافتراضي تمنع استخدامه لتقييم التوازن؟ مجلة التأهيل الرياضي. 2008. 17(1): ص. 38-49.

ميتران ، إس ، إم جي. فورست ، ب. ليندلي ، إل ياو ، ودي.بي. تلة. امتدادات نموذج موجة القص فيري لعلم الأحياء الدقيقة الخطي وغير الخطي النشط. ميكانيكا الموائع غير النيوتونية. 2008 PMC2790219

Nie، Z.، Fava، D.، Rubinstein، M.، & amp Kumacheva، E. (2008) & # 8220Supermolecular & # 8221 تجميع نهايات القضبان النانوية الذهبية المنتهية بـ plymer & # 8220pom-poms & # 8221: تأثير pom-pom هيكل على أوضاع الارتباط. مجلة الجمعية الكيميائية الأمريكية. 130 (11): 3683-3689.

O & # 8217Brien، ET، 3rd، M.R. Falvo، D. Millard، B. Eastwood، R.M. تايلور ، الثاني ، و R. Superfine. صفائح الفبرين فائقة النحافة ذاتية التجميع. Proc Natl Acad Sci U S A. 2008. 105(49): ص. 19438-43. PMC2614779

O & # 8217Brien، ET، J. Cribb، D. Marshburn، R.M. تايلور ، الثاني ، و R. Superfine. الفصل السادس عشر: المعالجة المغناطيسية لقياسات القوة في بيولوجيا الخلية. طرق خلية بيول. 2008. 89: ص. 433-50.

بيك ، تي إم ، إم سي. Whitton و H. Fuchs ، تقييم تقنيات إعادة التوجيه للمشي في البيئات الافتراضية الكبيرة ، في إجراءات الواقع الافتراضي IEEE. 2008: رينو ، نيفادا. ص. 121-127.

Quammen و CW و R.M. تايلور الثاني. صورة الغلاف على علم الأحياء الحالي. 2008.

Quammen ، C.W. ، ريتشاردسون ، A.C. ، Haase ، J. ، Harrison ، B.D. ، Taylor ، RM ، & amp Bloom ، K.S. (2008) FluoroSim: بيئة حل المشكلات المرئية للفحص المجهري الفلوري ، في إجراءات ورشة عمل Eurographics حول الحوسبة المرئية للطب الحيوي، دلفت ، هولندا ، 6-7 أكتوبر ، 2008 ، ص 151-158. PMC2860625

Shusharina، N.P.، & amp Rubinstein، M. (2008 أنظمة التركيز في محاليل النجوم متعددة الإلكتروليت. الجزيئات الكبيرة .41 (1): 203-217.

Sonnenwald ، D.H. ، M. Whitton و K. Maclaughlin ، تقييم نظام تعاوني علمي: التحقيق في إمكانية تعاونية & # 8217s قبل النشر ، في العلم على الإنترنت، G. Olson ، A. Zimmerman ، و N. Bos ، محررون. 2008 ، مطبعة معهد ماساتشوستس للتكنولوجيا: بوسطن.

سبيرو ، أر سي ، إل فيشي ، جيه كريب ، دي بوبر ، في سواميناثان ، إي تي O & # 8217Brien، S.L. روجرز ، ور. سوبرفاين. نظام عالي الإنتاجية للمعالجة المغناطيسية للخلايا والبوليمرات والمواد الحيوية والبوليمرات والمواد الحيوية. Rev Sci Instrum. 2008. 79(8): ص. 083707. PMC2748383

Spero، R.، & amp Taylor II، R. (2008) يمكن للتضاريس المحتملة العددية تبسيط تفسير الحقول المتجهة ثنائية الأبعاد. تقرير تقنية علوم الكمبيوتر التابع لجامعة الأمم المتحدة.

Spero، R.C، Wolberg، A.، Lord، S.، & amp Superfine، R. (2008). & # 8220 فحص عالي الإنتاجية لجلطات الفيبرين: النقل والميكانيكا تقاس بالميكروبيدات. & # 8221 ملخصات الدم.

Superfine ، R. ، Swaminathan ، V. ، O & # 8217Brien ، ET ، Boucher ، R. ، Button ، B. ، & amp Estes ، A. Stall Force and Response of Lung Cilia. الجمعية الفيزيائية الأمريكية ، اجتماع مارس 2008 APS. 2008.

تايلور ، أ. ر (2009). مسابقة تصميم IEEE Visualization 2008. وجهات نظر التصور IEEE CG & ampA. المجلد. 29 ، رقم 3: ص 86-87.

تايلور ، آر سي إس أ. آر إم (2008). & # 8220Scalar المحتملة تضاريس يمكن تبسيط تفسير الحقول المتجهة ثنائية الأبعاد. & # 8221 تقرير تقنية علوم الكمبيوتر التابع لجامعة الأمم المتحدة # RT08-008.

تايلور ، آر إم ، 2 (2008). Haptics للتخيل العلمي. التقديم اللمسي: الأسس والخوارزميات والتطبيقات. M. Lin and M. Otaduy، A. K. Peters LTD.

Visnapuu، M.L.، Fazio، T.، Wind، S.، & amp Greene، EC (2008) مصفوفات متوازية من الآبار النانوية الهندسية لتجميع ستائر الحمض النووي مع تشتت جانبي محكوم. لانجموير. 24 (19): 11293-11299. PMC2748852

ويتون ، م. و S. Razzaque، Locomotion، in HCI Beyond the GUI: تصميم للواجهات اللمسية والكلامية والشمية وغيرها من الواجهات غير التقليدية، ب. كورتوم ، محرر. 2008 مورجان كوفمان: بيرلينجتون ، ماساتشوستس. ص. 107-146.

Whitton، M. and F. Brooks، Evaluating VE Component Technologies، in مكونات VE وتقنيات التدريبنيكلسون ، ج. كوهن ، ود. شمورو ، المحررين. في الصحافة ، Praeger Security International: Westport، CN.

ويتون ، إم وجي دي ويندت (2008). النمذجة والتقديم. البيئات الافتراضية للتدريب والتعليم: التطورات للجيش وما بعده. نيكلسون ودي شمورو وجيه كوهين. ويستبورت ، سي إن ، برايجر للأمن الدولي. 2:15 - 20.

Whitton، M. and Loftin، R.B.، Section Perspective: Virtual Environment Component Technologies، in مكونات VE وتقنيات التدريبنيكلسون ، ج. كوهن ، ود. شمورو ، المحررين. في الصحافة ، Praeger Security International: Westport، CN.

Wong، O.K.، Guthold، M.، Erie، DA، & amp Gelles، J. (2008) Interconvertible Lac Repressor-DNA Loops التي تم الكشف عنها بواسطة تجارب جزيء واحد. بلوس علم الأحياء. 6 (9): e232. PMC2553838

Zach، C، Gallup، D.، Frahm، J.M، Niethammer، M. ورشة عمل الرؤية والنمذجة والتصور 2008.

Zuo، P.، Picher، M.، Okada، S.F، Lazarowski، E.R، Button، B.، Boucher، R.C، Elston، T.C (2008). نموذج رياضي لتنظيم النوكليوتيدات على ظهارة مجرى الهواء. الآثار المترتبة على استتباب مجرى الهواء. مجلة الكيمياء البيولوجية. 283 (39): 26805-26819. PMC2546543

عبد الله ، إل.إتش ، وسي دبليو ديفيس. تنظيم إفراز الميوسين لخلية مجرى الهواء عن طريق مسارات تأشير الفسفرة التيروزينية. أنا J Physiol الرئة خلية Mol Physiol. 2007. 293(3): ص. L591-9.

بورلاند ، د.و إم آر تايلور ، 2. خريطة ألوان قوس قزح (لا تزال) تعتبر ضارة. IEEE Comput Graph Appl. 2007. 27(2): ص. 14-7.

باوتشر ، أر. دليل على جفاف سطح مجرى الهواء باعتباره الحدث الأولي في مرض مجرى الهواء التليف الكيسي. J متدرب ميد. 2007. 261(1): ص. 5-16.

باوتشر ، أر. جفاف سطح مجرى الهواء في التليف الكيسي: التسبب والعلاج. Annu Rev Med. 2007. 58: ص. 157-70.

باوتشر ، أر. التليف الكيسي: مرض من القابلية للتأثر بجفاف سطح مجرى الهواء. اتجاهات مول ميد. 2007. 13(6): ص. 231-40.

باوتشر ، أر. دليل على جفاف سطح مجرى الهواء باعتباره الحدث الأولي في مرض مجرى الهواء التليف الكيسي. J متدرب ميد. 2007. 261(1): ص. 5-16.

بوزارث ، E.L. ، A. Brooks ، R. Camassa ، H. Jing ، T.J. ليترمان ، ر. ماكلولين ، ر. سوبرفاين ، جيه توليدو ، و إل فيشي. تدور حلقات ملحمية في سائل لزج حول قضيب التحضير المسبق: النظرية والتجارب على المقياسين الجزئي والكلي. الفيزياء القس E الإحصائيات غير الخطية المواد اللينة فيز. 2007. 76(1 نقطة 2): ص. 016313.

Burette ، A. ، D. Feng ، D. Marshburn ، D. Jen ، R. Weinberg ، و R.M.T. ثانيًا. ToolBox: الانتقال إلى البعد الثالث. مجلة علم الأعصاب. 2007. 27: ص. 12757 & # 8211 12760.

بيرنز ، إي ، إس رازاكي ، إم ويتون ، إف بروكس. ماكبيت: الصورة الرمزية التي أراها أمامي وحركتها تجاه يدي (ملخص الملصق). في الواقع الافتراضي IEEE 2007. 2007. شارلوت ، نورث كارولاينا: IEEE.

بوتون ، ب ، إم بيشر ، و أر سي. باوتشر. التأثيرات التفاضلية للضغط الدوري والمستمر على إطلاق ATP والنقل المخاطي الهدبي بواسطة ظهارة مجرى الهواء البشري. ياء فيزيول. 2007. 580(جزء 2): ص. 577-92.

كريب ، ج ، دي هيل ، آر إم. تايلور الثاني ، L.Vicci ، J.K. فيشر ، ك.ديساي ، إم جي. الغابة ، و R. Superfine. علم الريولوجيا غير الخطية لحلول Lambda-DNA المتشابكة عن طريق الريولوجيا الميكروبية مدفوعة. في الاجتماع السنوي لجمعية الفيزياء الحيوية. 2007. بالتيمور ، ماريلاند.

كريب ، ج ، بي ديفيد ، آر إم. تايلور ، L.Vicci ، J. Fisher ، K.V. ديساي ، إم. الغابة ، و R. Superfine. الريولوجيا اللاخطية لحلول لامدا DNA المتشابكة عبر ريولوجيا ميكروبيد مدفوعة. مجلة بيوفيزيائية. 2007: ص. 638A-638A.

ديساي ، ك.ف. ، إ. O & # 8217Brien و J. Cribb و R. Superfine. تعتمد استجابة الزحف غير الخطية الخلوية على تثبيت الغشاء: دراسة القوة المغناطيسية. في اجتماع جمعية الفيزياء الحيوية. 2007. بالتيمور ، ماريلاند: مجلة بيوفيزيكال.

ديساي ، ك.ف. ، إ. O & # 8217Brien و J. Cribb و R. Superfine. تعتمد استجابة الزحف غير الخطية الخلوية على تثبيت الغشاء: دراسة القوة المغناطيسية. مجلة بيوفيزيائية. 2007: ص. 420a-420a.

إيستوود ، ب. تايلور. إزالة الانسداد في الفحص المجهري بالفيديو. التحليل الحاسوبي للصور والأنماط ، Springer Berlin. 2007. 4673: ص. 125 & # 8211132.

إيفانز ، بكالوريوس ، أ. شيلدز ، آر إل كارول ، إس واشبورن ، إم آر فالفو ، آر. سوبرفاين. صفائف nanorod المشغلة مغناطيسيًا كأهداب مقلدة حيويًا. نانو ليت. 2007. 7(5): ص. 1428-1434.

فنغ ، دي ، دي مارشبورن ، دي جين ، آر جيه. واينبرغ ، ر. تايلور ، الثاني ، وأ. بوريت. الدخول في البعد الثالث. ياء نيوروسسي. 2007. 27(47): ص. 12757-60.

فيشر ، ج.ك. ، ل.فيشي ، ك.بلوم ، إ. O & # 8217Brien، C.W. Davis، R.M. Taylor II، and R. Superfine، Magnetic Manipulation for the Biomedical Sciences، in كتيب علوم النانو والهندسة والتكنولوجيا ، الطبعة الثانية. 2007 ، CRC Press LLC: Boca Raton.

جلينكروس ، إم ، سي جاي ، جيه فيسل ، إل كوهلي ، إم سي. ويتون ، و ر. هوبولد. التفاعل اللمسي التعاوني الفعال عبر الإنترنت. في وقائع IEEE Virtual Reality 2007. 2007.

M. Guthold، W. Liu، EA Sparks، LM Jawerth، L. Peng، M. Falvo، R. Superfine، RR Hantgan، ST Lord (2007) "مقارنة بين الخصائص الميكانيكية والهيكلية لألياف الفيبرين مع ألياف البروتين الأخرى "الكيمياء الحيوية للخلية والفيزياء الحيوية 49 ، 165-181.

جوتهولد ، إم ، دبليو ليو ، إي. سباركس ، إل إم جاويرث ، إل بينج ، إم فالفو ، ر. سوبرفاين ، آر آر هانتجان ، وس. رب. مقارنة الخواص الميكانيكية والهيكلية لألياف الفبرين بألياف البروتين الأخرى. الخلية Biochem Biophys. 2007. 49(3): ص. 165-81.

Hall ، AR ، M.R. Falvo ، R. Superfine ، و S.Washburn. الاستجابة الكهروميكانيكية للأنابيب النانوية الكربونية أحادية الجدار للإجهاد الالتوائي في جهاز مستقل بذاته. تقنية النانو الطبيعة. 2007. 2: ص. 413-416.

هيكي ، أ.ج. ، هـ. منصور ، إم جي تيلكو ، Z. Xu ، H.D. سميث ، ت. مولدر ، آر ماكلين ، جيه لانجريدج ، ود. التوصيف الفيزيائي للجزيئات المكونة في أجهزة الاستنشاق بالمسحوق الجاف. 1. مراجعة الاستراتيجية والخصائص الثابتة. علوم فارم J. 2007. 96(5): ص. 1282-301.

هيرش ، AJ ، جيه آر ستونبراكر ، كاليفورنيا. فان هيوسدن ، إي آر لازاروفسكي ، أر. باوتشر وم. بيشر. ينظم الأدينوزين ديميناز 1 وناقلات النوكليوزيدات المركزة 2 و 3 الأدينوزين على السطح القمي لظهارة مجرى الهواء البشري: الآثار المترتبة على أمراض الرئة الالتهابية. الكيمياء الحيوية. 2007. 46(36): ص. 10373-83.

جيرالد ، جيه ، إيه فولر ، إيه لاسترا ، إم سي. ويتون ، إل كوهلي ، و ف. بروكس. تعويض زمن الوصول عن طريق تحديد خط المسح الأفقي للشاشات المثبتة على الرأس. في إجراءات SPIE Vol 6490 المجسمة وأنظمة الواقع الافتراضي. 2007.

Kreda ، S.M. ، S.F. أوكادا ، كاليفورنيا. van Heusden، W. O & # 8217 Neal، S. Gabriel، L. Abdullah، C.W. Davis، R.C. باوتشر ، وإي آر لازاروفسكي. الإطلاق المنسق للنيوكليوتيدات والميوسين من خلايا Calu-3 الظهارية في مجرى الهواء البشري. مجلة فيزيولogy. 2007. 584(نقطة 1): ص. 245-59. PMC2277076

Liu، W.، Bonin، K. Guthold، M. (2007) "طريقة سهلة ومباشرة لمعايرة قياسات القوة الجانبية AFM" مراجعة الأدوات العلمية 78 ، 063707 (7 صفحات)

Mitran، S. النموذج الحسابي للتصفية المخاطية الهدبية & # 8211 الصلة بالعلاج. أمراض الرئة لدى الأطفال. 2007: ص. 111-112.

ميتران ، إس. تشكيل الموجة المتاخمة في نموذج الأهداب الرئوية. هيكل الكمبيوتر. 2007. 85(11-14): ص. 763-774.

O & # 8217Brien، ET، III، B. Wilde، S. Massenburg، K. Desai، R.M. تايلور ، الثاني ، دي مارشبورن ، ور. سوبرفاين. تعتمد استجابة الزحف غير الخطية الخلوية على تثبيت الغشاء: دراسة القوة المغناطيسية. في اجتماع جمعية الفيزياء الحيوية. 2007. بالتيمور ، ماريلاند: مجلة بيوفيزيكال.

Peng، L.، Stephens، B. J.، Bonin، K.، Cubicciotti، R.، Guthold، M.، (2007) “NanoSelection® - a Novel، غير مرتبطة-طريقة الدورة للاختيار فرد أنواع Aptamer من مجموعة صغيرة من Oligonucleotides العشوائية "المجهر البحث والتقنية 70 ، 372-381

بينغ ، إل ، بي جيه ستيفنز ، ك. بونين ، آر كوبيكشيوتي ، إم جوثولد. تقنية مجهرية مشتركة للقوة الذرية / الفلورية لاختيار الأبتاميرات في دورة واحدة من مجموعة صغيرة من قليل النيوكليوتيدات العشوائية. تقنية الدقة المجهرية. 2007. 70(4): ص. 372-81.

روبنشتاين ، م. فيزياء البوليمر للطبقة الصفائحية. أمراض الرئة لدى الأطفال. 2007: ص. 112-113.

سيرز ، العلاقات العامة ، ك.طومسون ، إم آر نولز ، وسي دبليو ديفيس. نموذج تجريبي للديناميات الهدبية لظهارة مجرى الهواء البشري. مجلة بيوفيزيائية. 2007: ص. 486A-486A.

شيلدز ، أ. صفائف Nanorod المشغَّلة مغناطيسيًا مثل Silia المحاكي الحيوي. رسائل نانو. 2007. 7(5): ص. 1428-1434.

سبيرو ، أر سي ، بي سميث ، إل فيشي ، جيه كريب ، إي تي. O & # 8217 برين ، إس تي. لورد ، ور. رقيق. الريولوجيا Microbead عالية الإنتاجية من الهلام الفيبرين. في اجتماع جمعية الفيزياء الحيوية. 2007. بالتيمور ، ماريلاند: مجلة بيوفيزيكال.

سبيرو ، أر سي ، بي سميث ، إل فيشي ، جيه كريب ، إي تي. O & # 8217 برين ، إس تي. لورد ، ور. رقيق. ريولوجيا ميكروبيد عالية الإنتاجية من المواد الهلامية الفيبرين. مجلة بيوفيزيائية. 2007: ص. 521a-521a.

صن ، إف سي ، أ. دوبرينين ، د. شيرفانيانتس ، هـ. Lee ، K. Matyjaszewski ، G.J. روبنشتاين ، إم. روبنشتاين ، و إس إس شيكو. نظرية فلوري للخلائط غير المتماثلة بنيوياً. رسائل المراجعة البدنية. 2007. 99(13).

تاناس ، إم ، ن. بيايس ، إم شيتز. ملاقط مغناطيسية في بيولوجيا الخلية. طرق خلية بيول. 2007. 83: ص. 473-93.

وينترز ، إس إل ، سي دبليو ديفيس ، وآر سي. باوتشر. الحساسية الميكانيكية لتردد ضربات الهدبية في القصبة الهوائية: أدوار Ca2 + ، إشارات البيورينجيك ، التوتر ، واللزوجة. أنا J Physiol الرئة خلية Mol Physiol. 2007. 292(3): ص. L614-24.

شو ، ك ، إم جي. فورست ، وأنا كلابر. على المراسلات بين التدفقات الزاحفة للسوائل اللزجة والمطاطية اللزجة. مجلة ميكانيكا السوائل غير النيوتونية. 2007. 145(2-3): ص. 150-172.

Asokan، S.، R.L. Caroll، S. Washburn، R.E. تشيني ، ور. سوبرفاين. يمكن أن يؤدي تدفق السوائل إلى توجيه خيوط الأكتين المتحركة في قنوات الموائع الدقيقة. مجلة بيوفيزيائية. 2006.

بيرنز ، إي و ف. بروكس جونيور الحساسية الإدراكية للتباين البصري / الحركي في سرعة اليد ، ولماذا قد نهتم. في VRST 2006. 2006. سيماسول ، قبرص.

بيرنز ، إ. ، س. رزاق ، أ. بانتر ، م. ويتون ، إم آر ماكالوس ، و ف. يد بروكس جونيور أسهل خداعًا من العين: المستخدمون أكثر حساسية للتداخل البصري من التناقض المرئي. مجلة عن الوجود: Teleoperators والبيئات الافتراضية. 2006. 15(1): ص. 1-15.

بيرنز ، إ. ، إس. رزاق ، إم سي. ويتون ، و ف. بروكس. MACBETH: Manadement of Avatar Conflict عن طريق توظيف تقنية هجينة. المجلة الدولية للواقع الافتراضي. 2006. 6(2): ص. 11-20. بيرنز 2006

كريب ، ج. ، د. هيل ، ج. فيشر ، جيه شيهان ، إم. روبنشتاين ، إم جي. الغابة ، و R. Superfine. التباين والمقارنة بين الخواص الريولوجية المجهرية والماكروسكوبية لامبدا DNA ومخاط مجرى الهواء البشري. مجلة بيوفيزيائية. 2006.

فيلدينغ ، جيه آر ، دي بورلاند ، كيه إتش. لي ، جي بي كلارك ، إي والين ، آر بروثي ، و آر إم. تايلور. تنظير الحويضة الافتراضي باستخدام تقشير العمق الحجمي. أكاد راديول. 2006. 13(6): ص. 759-63.

فيشر ، ج.ك. ، ج.كريب ، ك. ديساي ، L.Vicci ، B. Wilde ، K. Keller ، R.M. تايلور ، ج. هاس ، ك. بلوم ، إي. O & # 8217Brien ، و R. Superfine. نظام قوة مغناطيسية رقيقة الرقائق للفحص المجهري ذو الفتحة الرقمية العالية. Rev Sci Instrum. 2006. 77(2):

فيشر ، جيه كيه ، إل فيشي ، جيه كريب ، إي. O & # 8217Brien، R.M. تايلور ، ور. أنظمة المعالجة الدقيقة للقوة المغناطيسية للعلوم البيولوجية. نانو. 2006. 1(3): ص. 191-205.

Hall، A.R.، L. An، J. Liu، L. Vicci، M.R. Falvo، R. Superfine، and S. Washburn. قياس تجريبي لخصائص الالتواء للأنابيب النانوية الكربونية أحادية الجدار. فيس القس ليت. 2006. 96(25): ص. 256102.

جونز ، إم جي ، إم آر فالفو ، بي. برودويل ، وس. دوتر. التجميع الذاتي - كيف تبني الطبيعة. مدرس العلوم. 2006.

كلابر ، آي ، ك زو ، إم جي. غابة. علاقات المعاملة بالمثل بين تدفقات Stokes من السوائل اللزجة والمطاطية. مجلة ميكانيكا السوائل غير النيوتونية. 2006.

Liu، W.، Jawerth، L.M، Sparks، E. A.، Falvo، M. R.، Hantgan، R. R.، Superfine، R.، Lord، S. T.، Guthold، M.، (2006) "Fibrin Fibers have Extraordinary Extensibility and Elasticity" علم 313, 634

ليو ، دبليو ، إل إم جاويرث ، إي. سباركس ، إم آر فالفو ، آر آر هانتجان ، آر سوبرفاين ، إس تي. لورد وم. جوتهولد. ألياف الفبرين لها مرونة غير عادية في التمدد. علم. 2006. 313(5787): ص. 634.

Martin، J.، Procedural House Generation: طريقة لتوليد مخططات الطوابق بشكل ديناميكي (ملصق) ، في ندوة ACM لعام 2006 حول الرسومات والألعاب التفاعلية ثلاثية الأبعاد. 2006 ، ACM: Redwood City ، CA.

ماتسوي ، هـ. ، في. واغنر ، دي. هيل ، الولايات المتحدة شواب ، تي دي روجرز ، بي باتون ، آر إم. Taylor، 2nd، R. Superfine، M. Rubinstein، B.H. Iglewski و R.C. باوتشر. ارتباط مادي بين جفاف سطح مجرى الهواء بالتليف الكيسي والأغشية الحيوية الزائفة الزنجارية. Proc Natl Acad Sci U S A. 2006. 103(48): ص. 18131-6.

مولر ، بي ، جيه كوهن ، دي شمورو ، آر ستريبلينج ، كيه ستريبلنج ، ك.ستانني ، إل ميلهام ، إم سي. ويتون وجيه فولكس. مصفوفة الإخلاص: تخطيط النظام لمخرجات التدريب. في وقائع IITSEC 2007. 2006.

بينغ ، إل ، بي جيه ستيفنز ، ك. بونين ، آر كوبيكشيوتي ، إم جوثولد. قوة ذرية مشتركة / تقنية مجهرية مضان لاختيار Aptamers في دورة واحدة من مجموعة صغيرة من Oligonucleotides العشوائية. بحوث وتقنيات الفحص المجهري. 2006.

براكاش ، ر. ، ر. سوبرفاين ، إس واشبورن ، وإم آر فالفو. تشغيل الأنابيب النانوية الكربونية بالبروتينات والنقاط الكمية في محاليل عازلة مائية. رسائل الفيزياء التطبيقية. 2006. 88(063102).

رانديل ، S.H. و آر سي. باوتشر. تعتبر إزالة المخاط بشكل فعال أمرًا ضروريًا لصحة الجهاز التنفسي. أنا J Respir Cell Mol Biol. 2006. 35(1): ص. 20-8.

سكينر ، ك ، سي دواير ، إس واشبورن. التفعيل الانتقائي للأسلاك النانوية التعسفية. نانو ليت. 2006. 6(12): ص. 2758-62.

Sonnenwald ، D.H. ، M. Whitton ، و K.Maglaughlin ، تقييم النظام التعاوني العلمي: التحقيق في إمكانية تعاونية & # 8217s قبل النشر ، في العلم على الإنترنت، A.Z.N.B. G. أولسون ، محرر. 2006 ، مطبعة معهد ماساتشوستس للتكنولوجيا: بوسطن.

Sul ، O.J. ، M.R. Falvo ، R.M. تايلور الثاني ، إس واشبورن ، و آر. الأجهزة الدقيقة للقاطرات التي تعمل بالحرارة وغير المربوطة والتي تعمل حرارياً. تطبيق فيز. بادئة رسالة.. 2006. 89(20): ص. 203512.

وين ، كيو ، سي هيلي ، م. ويتون ، و R.M. تايلور الثاني. مقارنة بين أداء المستخدم في HMD الغامرة ، وهو حوض للأسماك مع شاشات لمسية لتصور البيانات الحجمية. وقائع الإدراك التطبيقي في الجرافيك والتصور 2006. 2006: ص. 8 صفحات.

بورلاند ، د. ، جيه كلارك ، و آر إم. تايلور الثاني. تقشير العمق الحجمي لتنظير المفاصل الافتراضي. النشرة الإخبارية للمجموعة الفنية الدولية SPIE. 2005. 16(2): ص. 1.

بيرنز ، إ. ، س. رزاق ، أ. ت. بانتر ، م. ويتون ، إم آر ماكالوس ، و ف. بروكس جونيور اليد أبطأ من العين: استكشاف كمي للهيمنة البصرية على الحس العميق. في وقائع الواقع الافتراضي IEEE 2005. تنويه مشرف في مسابقة أفضل ورقة. 2005: جمعية IEEE للكمبيوتر.

بيرنز ، إ. ، إس. رازاكي ، إم سي. ويتون ، إم آر ماك كالوس ، إيه تي. بانتر و ف. بروكس جونيور. اليد هي التي تنخدع بسهولة أكثر من العين: المستخدمون أكثر حساسية للتداخل البصري من التناقض البصري التحسسي. التواجد: Teleoperators والبيئات الافتراضية. 2005.

كريب ، ج. ، د. هيل ، ر. تايلور ، L.Vicci ، J. Fisher ، K.V. ديساي ، ب.وايلد ، جيه شيهان ، إم جي. الغابة ، و R. Superfine. قياس الخواص الميكروية المحلية للمخاط البشري بواسطة ميكروبيدات مدفوعة مغناطيسيًا. مجلة بيوفيزيائية. 2005. 88(1): ص. 505 أ -505 أ.

فيشر ، جيه كيه ، جيه آر كامينغز ، ك. ديساي ، إل فيشي ، بي وايلد ، ك.كيلر ، سي ويجل ، جي بيشوب ، آر إم. تايلور ، سي دبليو ديفيس ، أر سي. باوتشر ، إي. O & # 8217Brien ، و R. Superfine. مجهر القوة ثلاثي الأبعاد: نظام تتبع بصري نانومتري ومعالجة مغناطيسية للعلوم الطبية الحيوية. مراجعة الأدوات العلمية. 2005. 76(5).

هيل ، دي بي ، جيه كريب ، إتش ماتسوي ، وآر سوبرفاين. التذبذبات في تدفق المخاط. مجلة بيوفيزيائية. 2005. 88(1): ص. 505a-505 أ.

هولينز ، إم ، إف لورينز ، إيه سيجر ، ر. تايلور. العوامل المساهمة في تكامل الصفات التركيبية: دليل من الأسطح الافتراضية. Somatosens Mot Res. 2005. 22(3): ص. 193-206.

كوهلي ، إل ، إي بيرنز ، دي ميلر ، و إتش فوكس. الجمع بين اللمسات اللمسية السلبية والمشي المعاد توجيهه. في المؤتمر الدولي للواقع الاصطناعي والتعايش (ICAT) 2005. 2005. كرايستشيرش ، نيوزيلندا.

كوهلي ، ل. و م. ويتون. اليد اللمسية: تقديم ملاحظات حول واجهة المستخدم مع اليد غير المسيطرة في البيئات الافتراضية. في وقائع واجهة الرسومات 2005. 2005.

مارشبورن ، دي ، سي ويجل ، بي جي. وايلد ، ك.ديساي ، ج.ك. فيشر ، ج. كريب ، إي. أوبراين ، و R. Superfine ، و R.M.T. ثانيًا. واجهة البرنامج لمجهر القوة ثلاثية الأبعاد. وقائع IEEE التصور. 2005: ص. 455-462.

ميهان ، م ، س. رزاكي ، ب. إنسكو ، إم. ويتون ، و ف. Brooks، Jr. مراجعة لأربع دراسات حول استخدام التفاعل الفسيولوجي كمقياس للوجود في البيئات الافتراضية المجهدة. تطبيق Psychophysiol Biofeedback. 2005. 30(3): ص. 239-58.

بينغ ، ل. ، ر. كوبيشيوتي ، وم. منهجية جديدة أحادية الجزيء لتحديد Aptamers الجديدة. مجلة بيوفيزيائية. 2005. 88(1): ص. 65A الجزء 2 ملحق S.

Stadermann ، M. ، S.J. Papadakis ، M.R. Falvo ، Q. Fu ، J. Liu ، Y. Fridman ، J.J. بورلاند ، ر. سوبرفاين ، وس. واشبورن. الاضمحلال الأسي للتوصيل المحلي في الأنابيب النانوية الكربونية أحادية الجدار. فيز. القس ب.. 2005. 72(24): ص. 245406.

Whitton ، MC ، J. Cohn ، J. Feasel ، P. Zimmons ، S. Razzaque ، J. Poulton ، B. McLeod ، and F.P. بروكس الابن مقارنة واجهات حركة VE. في وقائع IEEE الواقع الافتراضي 2005. 2005. بون ، ألمانيا: IEEE Computer Society.

Whitton ، MC ، J. Cohn ، J. Feasel ، P. Zimmons ، S. Razzaque ، S. Poulton ، B. McLeod ، and F.P. بروكس. مقارنة واجهات حركة VE. في وقائع IEEE الواقع الافتراضي 2005. 2005.

كوهن ، م. ويتون و دبليو بيكر و ف. بروكس ، عرض المعلومات وأداء أسلوب التحكم في التأثير على مهمة الحركة الافتراضية المعقدة (الملخص) ، في مجتمع العوامل البشرية وبيئة العمل. 2004: نيو اورليانز ، لو.

دواير ، سي ، آر إم. تايلور الثاني ، إل فيشي ، وجيه بولتون. معماريات الكمبيوتر المتوازية التي تم تمكينها من خلال التجميع الذاتي. وقائع المؤتمر الأول حول أسس علم النانو. 2004. 379.

دوير ، سي ، إل فيشي ، جيه بولتون ، دي إيري ، آر سوبرفاين ، إس واشبورن ، و آر إم. تايلور الثاني. تصميم دوائر الحوسبة ذاتية التجميع للحمض النووي. IEEE Trans. على VLSI. 2004. 12: ص. 1214-20.

دواير ، سي ، إل فيشي ، جيه بولتون ، و آر إم. تايلور الثاني. معماريات الكمبيوتر المتوازية المجمعة ذاتيًا للحمض النووي. تقنية النانو. 2004. 15: ص. 1688-1694.

Guthold، M.، Liu، W.، Stephens، BJ، Lord، ST، Hantgan، RR، Erie، DA، Taylor، RM، Superfine، R. (2004) "التصور والمعالجات الميكانيكية لألياف الفيبرين الفردية تشير إلى أن الألياف المتقاطعة - القسم له بعد كسوري 1.3 " بيوفيز. ج. 87, 4226-36

جوتهولد ، إم ، دبليو ليو ، بي ستيفنس ، إس تي. لورد ، R.R. Hantgan ، D.A. إيري ، ر. تايلور الابن ، و R. Superfine. يشير التصور والمعالجة الميكانيكية لألياف الفيبرين الفردية إلى أن المقطع العرضي للألياف له بُعد كسري 1.3. بيوفيس ج. 2004. 87(6): ص. 4226-36. 15465869

هولينز ، إم ، إيه سيجر ، جي بيلي ، ر. تايلور. الإدراك اللمسي للأسطح الافتراضية: تحجيم الصفات الذاتية والاختلافات بين التحفيز. تصور. 2004. 33(8): ص. 1001-19. 15521697

هدسون ، ت. ، م. ويتون ، إيه هيلسر ، ودي إتش سونينوالد. إدارة التعاون في nanoManipulator. حضور. 2004. 13(2).

جين ، دي ، بي بارنتي ، جيه روبينز ، سي ويجل ، آر إم. تايلور الثاني ، أ.بوريت ، ور. واينبرغ. ImageSurfer: أداة لتصور الارتباطات بين مجلدين عددي الحجم. في إجراءات IEEE Visualization 2004. 2004. أوستن ، تكساس.

جونز ، جي ، تي تريتر ، إيه بوكينسكي ، إيه نيغيشي. تكنولوجيا اللمس والتعلم. Haptics-e. 2004.

جونز ، إم جي ، تي أندريه ، دي كوباسكو ، إيه بوكينسكي ، تي تريتر ، إيه نيجيشي ، آر إم. تايلور الثاني ، و ر. التحقيقات العملية فائقة الدقة مع الكائنات المجهرية. تعليم العلوم. 2004.

جونز ، إم جي ، تي أندريه ، دي كوباسكو ، إيه بوكينسكي ، تي تريتر ، إيه نيجيشي ، آر إم. تايلور الثاني ، و ر. تعليم العلوم. 2004. 88: ص. 55-71.

جونز ، إم جي ، جيه مينوغ ، تي تريتر ، إيه نيجيشي ، و آر إم. تايلور الثاني. التعزيز اللمسي لتعليم العلوم: هل اللمس مهم؟ تعليم العلوم. 2004.

جونز ، إم جي ، تي تريتر ، إم بايشتر ، دي كوباسكو ، وأيه بوكينسكي. متفرج أم مشارك؟ الطلاب الأمريكيون من أصل أفريقي & # 8217 الكتابة عن العلوم. تعليم العلوم. 2004.

لاب ، ج.ك. ، إ. مكارثي ، وب. غولدشتاين. يتم تقييد القوى التي تضع المغزل الانقسامي بشكل غير متماثل حتى بعد وقت تجميع المغزل. J خلية بيول. 2004. 167(2): ص. 245-56. 15492042

Lok، B.، S. Naik، M.C. ويتون ، و ف. بروكس جونيور.آثار التعامل مع الأشياء الحقيقية وإخلاص الصورة الرمزية الذاتية على أداء المهام الإدراكية والشعور بالوجود في البيئات الافتراضية. مجلة عن الوجود: Teleoperators والبيئات الافتراضية. 2004. 12(6): ص. 615-628.

ماثيوز ، دبليو جي ، إيه نيجيشي ، دي إم. مكارتي ، R.J. سامولسكي ، ر. تيلور الثاني ، و ر. لانجموير. 2004.

Negishi، A.، J. Chen، D.M. مكارتي ، R.J. Samulski و J. Liu و R. Superfine. تحليل التفاعل بين الفيروس المرتبط بالغدة وكبريتات الهيباران باستخدام الفحص المجهري للقوة الذرية. بيولوجيا السكر. 2004. 14(11): ص. 969-77. 15215232

Paechter ، M. ، M.G. جونز ، تي تريتر ، إيه بوكينسكي ، دي كوباسكو ، إيه نيجيشي ، وتي أندريه. التدريب العملي على تعليم العلوم: تصميم تعليمات تجذب الطلاب والطالبات. 2004.

الرسام ، J. ، M.G. جونز ، د. كوباسكو ، ت.ترتر ، إيه نيجيشي ، وتي أندريه. سحب الستار للخلف: العلماء في الفصل. العلوم المدرسية والرياضيات. 2004.

باباداكيس ، S.J. ، A.R. هول ، ب. ويليامز ، إل فيشي ، إم آر فالفو ، آر سوبرفاين ، إس واشبورن. مذبذبات الرنين مع نوابض التواء أنابيب الكربون النانوية. رسائل المراجعة البدنية. 2004. 93: ص. 146101.

Stadermann ، M. ، S.J. باباداكيس ، إم آر فالفو ، جيه نوفاك ، إي سنو ، كيو فو ، جيه ليو ، واي فريدمان ، ج. بولاند ، ر. سوبرفاين ، وس. واشبورن. دراسة المقياس النانوي للتوصيل عبر شبكات الأنابيب النانوية الكربونية. المراجعة البدنية ب. 2004. 69(20): ص. 201402.

سول ، O. ، S.J. باباداكيس ، إم آر فالفو ، واي فريدمان ، ر. تايلور الثاني ، ر. سوبرفاين ، وس. واشبورن. مشغلات ثنائية الأشكال تعتمد على الأنابيب النانوية الكربونية: الانحناء الحراري لأنابيب الأنابيب النانوية المعدنية. تطبيق فيز. بادئة رسالة.. 2004.

تايلور الثاني ، آر إم ، دي بورلاند ، ف. بروكس جونيور ، إم. فالفو ، إم جوثولد ، تي هدسون ، ك.جيفاي ، جي جونز ، دي مارشبورن ، إس جيه. باباداكيس ، ل. تشين ، أ.سيجر ، ف.د. سميث ، دي إتش سونينوالد ، آر سوبرفاين ، إس واشبورن ، سي ويجل ، إم سي. Whitton، P. Williams، L. Vicci، and W. Robinett، Visualisation and Natural Control Systems for Microscopy، in كتيب التصور، سي. هانسن ، محرر. 2004 مطبعة هاركورت الأكاديمية. ص. 875-900.

أسكان ، إس بي ، إل إم جاويرث ، آر إل كارول ، R.E. تشيني ، S. رسائل نانو. 2003. 3(4): ص. 431-437.

Bokinsky ، A. البقع المدفوعة بالبيانات: تقنية التصور الطبقي للعرض التفاعلي لمتغيرات عددي متعددة الأبعاد ثنائية الأبعاد ، في علوم الكمبيوتر 2003 ، جامعة نورث كارولينا: تشابل هيل

بروكس جونيور ، ف.ب ، مقدمة ، إن مستوى التفصيل للرسومات ثلاثية الأبعاد، D. Luebke ، وآخرون ، المحررين. 2003 ، دار نشر مورجان كوفمان: سان فرانسيسكو ، كاليفورنيا. ص. التاسع.

بروكس جونيور ، ف. دمج الكائنات الحقيقية الديناميكية في بيئات افتراضية غامرة. في إيه سي إم سيجراف. 2003. سان دييغو ، كاليفورنيا: معاملات ACM على الرسومات.

كارتر ، ج. جونز وم. روا. تأثير قدرة الشريك على الإنجاز والتنظيم المفاهيمي لطلاب الصف الخامس المتفوقين. تعليم العلوم. 2003. 87(1): ص. 94-111.

كريستيانسن ، ن. وك. ماجلولين. العبور من مكان العمل الفعلي إلى مساحة العمل الافتراضية: كن على علم. في المؤتمر الدولي للتفاعل بين الإنسان والحاسوب. 2003.

دواير ، سي ، آر إم. تايلور الثاني ، ول. محاكاة أداء منطق الترانزستور ذو التأثير الميداني لقضيب السيليكون النانوي. IEEE Trans. على تقنية النانو. 2003. 2(2): ص. 69-74.

Hall، A.، G. Matthews، R. Superfine، M. Falvo، and S.Washburn. طريقة بسيطة وفعالة لربط الأنابيب النانوية الكربونية بمجسات المسح والركائز الأخرى. تطبيق فيز. بادئة رسالة.. 2003. 82(15): ص. 2506-2508.

هدسون ، ت ، إيه هيلسر ، دي إتش سونينوالد ، إم سي. ويتون. إدارة التعاون في nanoManipulator الموزع. في الواقع الافتراضي IEEE 2003. 2003. لوس أنجلوس ، كاليفورنيا: مطبعة IEEE.

هدسون ، ت. تكييف التطبيقات التفاعلية للبيئات الموزعة ، في علوم الكمبيوتر 2003 ، UNC-CH: تشابل هيل

جونز ، ج ، أ.بوكينسكي ، ت.ترتر ، إيه نيجيشي ، دي كوباسكو ، ر.تايلور الثاني ، الفحص المجهري للقوة الذرية باللمس: تطبيقات تعليمية ، بلغة العلوم والتكنولوجيا وتعليم الفحص المجهري: نظرة عامة، A. Mendez-Vilas، Editor. 2003 ، فورماتيكس: مدريد ، إسبانيا.

جونز ، جي ، تي أندريه ، ر. سوبرفاين ، و آر إم. تايلور الثاني. التعلم على المقياس النانوي: تأثير الطلاب & # 8217 استخدام الفحص المجهري عن بعد على مفاهيم الفيروسات والقياس والميكروسكوب. مجلة البحث في تدريس العلوم. 2003. 40(3): ص. 303-322.

جونز ، إم جي ، تي هارجروف ، وبي جونز. الاستعارات الفاشلة للتعليم. مدير المدرسة. 2003. 60(11): ص. 26-28.

Lok ، B. تقييم وتطبيق الخوارزميات لنظام بيئة هجين ، في التصور والتلاعب الميكانيكي لألياف الفيبرين الفردية، ب. طومسون ، محرر. 2003 ، مطبعة جامعة روتشستر: نيويورك. ص. 149-175.

Lok، B.، S. Naik، M.C. ويتون ، و ف. بروكس جونيور.آثار التعامل مع الكائنات الحقيقية وإخلاص الصور الرمزية على أداء المهام المعرفية في البيئات الافتراضية. في الواقع الافتراضي IEEE 2003. 2003. لوس أنجلوس ، كاليفورنيا.

ماجلولين ، ك. استكشاف عوامل التعاون العلمي الأكاديمي متعدد التخصصات. ، في كلية المعلومات وعلوم المكتبات 2003 ، جامعة نورث كارولينا في تشابل هيل:

ميهان ، م ، س. رزاق ، م. ويتون ، و ف. بروكس جونيور. تأثير الكمون على التواجد في البيئات الافتراضية المجهدة. في الواقع الافتراضي IEEE 2003. 2003. لوس أنجلوس ، كاليفورنيا.

باباداكيس ، S.J. ، P.A. ويليامز ، أو سول ، إم آر فالفو ، آر سوبرفاين ، إس واشبورن. ميكانيكا الأنابيب النانوية والأجهزة القائمة على الأنابيب النانوية. في Winterschool الدولية حول الخصائص الإلكترونية للمواد الجديدة. 2003. كيرشبرغ ، النمسا.

براكاش ، R. ، S. واشبورن ، R. Superfine ، R.E. تشيني ، وم. تصور الأنابيب النانوية الكربونية الفردية مع الفحص المجهري الفلوري باستخدام الفلوروفورات التقليدية. تطبيق فيز. بادئة رسالة.. 2003. 83: ص. 1219-1221.

Seeger، A.، C. Fretzagias، and R. Taylor، 2nd. تقنيات تسريع البرمجيات لمحاكاة مسح صور المجهر الإلكتروني. يتم المسح. 2003. 25(5): ص. 264-73. 14748390

Sonnenwald، D.H. توقعات تعاون علمي: دراسة حالة. في مؤتمر ACM GROUP 2003. 2003. نيويورك: مطبعة إيه سي إم.

Sonnenwald و D.H. و B. Li. التعاون العلمي في التعليم العالي: استكشاف تفضيلات أسلوب التعلم وتصورات التكنولوجيا. المجلة البريطانية لتكنولوجيا التعليم. 2003. 43(3): ص. 419-431.

Sonnenwald ، D.H. ، K.L. ماجلولين وم. ويتون. التصميم لدعم الوعي بالموقف عبر المسافات: مثال من التعاون العلمي. معالجة المعلومات وإدارة أمبير. 2003.

Sonnenwald ، D.H. ، M. ويتون وك. ماجلولين. تقييم التعاون العلمي: نتائج تجربة مضبوطة. معاملات ACM على التفاعل البشري الحاسوبي. 2003. 10(2): ص. 150-176.

Sonnenwald ، D.H. ، M. ويتون وك. ماجلولين. التعاون العلمي: تقييم إمكاناتها. تفاعلات ACM. 2003. 19(4): ص. 9-10.

Stadermann ، M. ربط الأنبوب النانوي بخريطة التوصيلية (تحدي التصور). علم. 2003. 301: ص. 1473.

Stadermann ، M. ، H. Grube ، J. Boland ، S.J. باباداكيس ، إم آر فالفو ، آر سوبرفاين ، إس واشبورن. القياس المجهري للقوة الذرية المتزامنة للتضاريس ومقاومة التلامس للأغشية المعدنية والأنابيب النانوية الكربونية. مراجعة الأدوات العلمية. 2003. 74(8): ص. 3653-3655.

ستيلويل ، جيه إل ، دي إم. مكارتي ، أ.نجيشي ، ر. سوبرفاين ، و آر جيه. سامولسكي. تطوير وتوصيف قفيصات الفيروس الغدي الفارغ وتأثيرها على التعبير الجيني الخلوي. ياء فيرول. 2003. 77(23): ص. 12881-5. 14610209

سول ، O. ، S.J. باباداكيس ، إم. فالفو ، واي فريدمان ، آر إم. مشغلات Taylor II و S.Washburn و R. تطبيق فيز. بادئة رسالة.. 2003.

تايلور الثاني ، آر إم ، سي وير ، وف.انترانت. تصميم التصور الإدراكي. في ملاحظات الدورة التدريبية لدورة SIGGRAPH 2003 رقم 45 ، دورة ليوم كامل حول التصور نظمها R.M. تايلور الثاني. 2003. سان دييغو ، كاليفورنيا.

تراتر ، ت. وج. جونز. إحساس المقياس: دراسة كيفية تأثير المقياس على الأنظمة والكائنات الحية. معلم العلوم. 2003. 70(1): ص. 22-25.

Tretter ، T. and M.G. جونز. العلاقات بين التدريس القائم على الاستفسار ونتائج الاختبارات المعيارية في العلوم الفيزيائية. العلوم المدرسية والرياضيات. 2003. 103(7): ص. 345-350.

Wang ، H. ، Y. Yang ، M.J. Schofield ، C. Du ، Y. Fridman ، S.D. لي ، إي. لارسون ، ج. دروموند وإي. علاني وبي. هسيه و د. إيري. الانحناء والفك للحمض النووي بواسطة MutS يحكم التعرف على عدم التطابق والخصوصية. Proc Natl Acad Sci U S A. 2003. 100(25): ص. 14822-7. 14634210

ويتون ، م. جعل البيئات الافتراضية مقنعة. اتصالات من ACM. 2003.

ويليامز ، ب ، إس جيه. Papadakis ، A. Patel ، M. Falvo ، S.Washburn ، و R. تطبيق فيز. بادئة رسالة.. 2003. 82: ص. 805.

تشانغ ، ج ، جي إل وانغ ، واي إس. شون ، أو. زو ، ر. سوبرفاين ، و آر موراي. تفاعلات الجزيئات الصغيرة والجسيمات النانوية Au مع الأنابيب النانوية الكربونية أحادية الجدار المذابة. مجلة الكيمياء الفيزيائية ب. 2003. 107(16): ص. 3726-3732.

Zimmons ، P. تأثير جودة الإضاءة على الحضور وأداء المهام في البيئات الافتراضية ، في علوم الكمبيوتر 2003 ، UNC-CH: تشابل هيل ، ص 244

بروكس جونيور ، إف بي ، تاريخ نظام تشغيل آي بي إم / 360 ، إن رواد البرمجيات: مساهمات في هندسة البرمجيات، M. Broy و E. Denert ، المحررين. 2002 ، سبرينغر: برلين. ص. 170-178.

دواير ، سي ، ر. تايلور ، و إل فيشي. محاكاة النقل لترانزستور التأثير الميداني لقضيب السيليكون النانوي. في مؤتمر IEEE الثاني حول تقنية النانو. 2002. أرلينغتون ، فيرجينيا.

دوير ، سي ، إم جوثولد ، إم فالفو ، إس واشبورن ، آر سوبرفاين ، ودي إيري. الأنابيب النانوية الكربونية أحادية الجدار التي تعمل بالحمض النووي. تقنية النانو. 2002. 13: ص. 601-4.

دواير ، سي ، ر. تايلور ، و إل فيشي. محاكاة الوضع المختلط لمنطق الترانزستور ذو التأثير الميداني لقضيب السيليكون النانوي. IEEE Trans. على تقنية النانو. 2002.

هاريس ، إم جي ، جي كومب ، تي شيرمان ، وأ. لاسترا. محاكاة بصرية جسدية على أجهزة الرسومات. في 2002 ورشة عمل SIGGRAPH / Eurographics حول أجهزة الرسومات. 2002. ساربروكن ، ألمانيا.

جونز ، إم جي ، تي أندريه ، دي كوباسكو ، إيه بوكينسكي ، تي تريتر ، إيه نيجيشي ، آر تايلور ، و آر سوبرفاين. تحقيقات عملية مع الكائنات المجهرية. تعليم العلوم. 2002.

لوك ، ب. التفاعل مع الكائنات الحقيقية الديناميكية في البيئات الافتراضية ، في علوم الكمبيوتر 2002 ، جامعة نورث كارولينا: تشابل هيل p.172

ماجلولين ، ك. و D.H. Sonnenwald. وجهات نظر المستخدم حول معايير الملاءمة: مقارنة بين الأحكام ذات الصلة وذات الصلة جزئيًا وغير ذات الصلة. مجلة الجمعية الأمريكية للمعلومات والتكنولوجيا. 2002. 53(5): ص. 327-342.

ميهان ، م ، ب. إنسكو ، إم. ويتون ، و ف. بروكس الابن المقاييس الفسيولوجية للوجود في البيئات الافتراضية المجهدة. معاملات ACM على الرسومات. 2002. 21(3): ص. 645-652.

مورتنسن ، جيه ، فيناياغامورثي ، إم سلاتر ، أ.ستيد ، ب.لوك ، إم سي. ويتون. التعاون في البيئات الغامرة عن بعد. في ورشة عمل Eurographics الثامنة حول البيئات الافتراضية. 2002. برشلونة ، إسبانيا: ACM & # 8211 The Eurographics Association.

رزاق ، إس ، دي.سواب ، إم سلاتر ، إم سي. ويتون ، و أ. ستيد. إعادة توجيه المشي في المكان. في ورشة عمل Eurographics الثامنة حول البيئات الافتراضية. 2002. برشلونة ، إسبانيا: ACM & # 8211 The Eurographics Association.

Sonnenwald ، D.H. ، M. ويتون وك. ماجلولين. المتعاونين العلميين. نشرة أيسيس و أمبير. 2002. 28(6).

Superfine ، R. ، M. Falvo ، R.M. تايلور الثاني ، وس. كتيب CRC لعلم النانو والهندسة والتكنولوجيا، S. Lyshevski ، وآخرون ، المحررين. 2002 ، CRC Press LLC: Boca Raton.

Superfine ، R. ، G. Bishop ، و J. Cummings ، و J. Fisher ، و K. Keller ، و G. Matthews ، و D. Sill ، و R.M. تايلور الثاني ، إل فيشي ، سي ويجل ، جي ويلش ، وبي وايلد. اللمس في النظم البيولوجية: مجهر قوة ثلاثية الأبعاد. في المجهر والتحليل الدقيق 2002. 2002. مدينة كيبيك ، كندا.

تايلور الثاني ، ر. تصور الحقول المتعددة على نفس السطح. رسومات وتطبيقات الكمبيوتر IEEE. 2002 (مارس - أبريل): ص. 6-10.

فارادان ، جي ، دبليو روبينيت ، دي إيري ، ور. تايلور الثاني. محاكاة سريعة للتصوير بالميكروسكوب للقوة الذرية للأسطح الذرية والمتعددة الأضلاع باستخدام أجهزة الرسومات. في مؤتمر SPIE حول التصور وتحليل البيانات. 2002. مركز مؤتمرات سان خوسيه ، سان خوسيه ، كاليفورنيا.

واشبورن ، إس. باباداكيس. النقل عبر الواجهات المحاذاة ذريًا: معالجة أطراف الأصابع والسبر الكهربائي للأنابيب النانوية. في ورشة عمل دولية حول التداخل الإلكتروني وفك الترابط في الهياكل النانوية. 2002. معهد ماكس بلانك لفيزياء الأنظمة المعقدة.

ويليامز ، با ، إس جيه. باباداكيس ، إم آر فالفو ، أ.م. باتيل ، إم سينكلير ، إيه سيغر ، إيه هيلسر ، آر إم. تايلور الثاني ، إس واشبورن ، و آر. وضع متحكم فيه لأنبوب نانوي كربوني فردي على هيكل كهروميكانيكي دقيق. رسائل الفيزياء التطبيقية. 2002. 80(14): ص. 2574-2576.

ويليامز ، با ، إس جيه. باباداكيس ، أ. باتيل ، إم آر فالفو ، إس واشبورن ، و آر سوبرفاين. الاستجابة الالتوائية وتصلب الأنابيب النانوية الكربونية الفردية متعددة الجدران. فيس القس ليت. 2002. 89(25): ص. 255502. 12484895

بروكس جونيور ، ف. تاريخ نظام تشغيل آي بي إم / 360. في مؤتمر رواد البرمجيات SD & ampM. 2001. بون ، ألمانيا.

جوتهولد ، م و د. إيري. دراسة جزيء واحد تكشف عن مركب E. coli RNA polymerase. كيمبيوتشيم. 2001. 2(3): ص. 167-70. 11828441

Guthold و M. و R. Superfine و R.M. تايلور الثاني. تتغير القواعد: فرض القياسات على الجزيئات المفردة وكيفية ارتباطها بحركية وطاقات التفاعل الكتلي. الأجهزة الطبية الحيوية. 2001. 3(1): ص. 9-18.

هاريس ، م و أ. لاسترا. عرض السحابة في الوقت الحقيقي. منتدى رسومات الحاسوب. 2001. 20(3): ص. 76-84.

هدسون ، تي سي ، إم سي. ويجل ، ك.جيفاي ، ور.م. تايلور الثاني. تجارب في شبكات الوسائط المتعددة ذات الجهد الأفضل من أجل بيئة افتراضية موزعة. وقائع الوسائط المتعددة الحوسبة والشبكات. 2001 (يناير): ص. 88-98.

Insko ، B. Haptics السلبية تعزز بشكل كبير البيئات الافتراضية ، في علوم الكمبيوتر 2001 ، جامعة نورث كارولينا: تشابل هيل

جيفاي ، ك. ، ت. هدسون ، وم.باريس. ما وراء الصوت والفيديو: دعم شبكات الوسائط المتعددة للبيئة الافتراضية الموزعة والغامرة. في المؤتمر السابع والعشرون EUROMICRO. 2001. وارسو ، بولندا.

ليندهولم ، إي ، إم جي كليجارد ، وه. موريتون. محرك قمة قابل للبرمجة من قبل المستخدم. في المؤتمر الدولي لرسومات الحاسوب والتقنيات التفاعلية. 2001: مطبعة إيه سي إم.

Lok، B. إعادة بناء النموذج عبر الإنترنت للبيئات الافتراضية التفاعلية. في ندوة ACM حول الرسومات التفاعلية ثلاثية الأبعاد. 2001.

ميهان ، إم ، بي إنسكو ، إم سي. ويتون ، و ف. بروكس. المقاييس الفسيولوجية للوجود في البيئات الافتراضية. في ورشة العمل الدولية الرابعة حول الحضور. 2001. فيلادلفيا.

ميهان ، م.التفاعل الفسيولوجي كمقياس موضوعي للوجود في البيئات الافتراضية ، في علوم الكمبيوتر 2001 ، جامعة نورث كارولينا: تشابل هيل p.142

رزاق ، س. ، ز. كون ، و م. ويتون. المشي المعاد توجيهه. في يوروجرافيكس 2001. 2001.

Seeger، A.، S. Paulson، M. Falvo، A. Helser، R.M. تايلور ، ر. سوبرفاين ، وس. واشبورن. كيف تشعر عندما تدحرج الجزيء؟ في المؤتمر الدولي الخامس والأربعون لتكنولوجيا شعاع الإلكترون والأيونات والفوتون والتصنيع النانوي. 2001.

Seeger، A.، S. Paulson، M. Falvo، A. Helser، R.M. تايلور الثاني ، ر. سوبرفاين ، وس. واشبورن. أدوات عملية لتقنية النانو. مجلة فراغ العلوم والتكنولوجيا أمبير. 2001. ب 19: ص. 2717-2722.

Sonnenwald، D.H.، R. E. Bergquist، K.L Maglaughlin، E. Kupstas-Soo، and M.C. Whitton ، تصميم لدعم البحث العلمي التعاوني عبر المسافات: بيئة nanoManipulator ، في البيئات الافتراضية التعاونية، إي تشرشل ، د. سنودون ، وأ. مونرو ، المحررين. 2001 ، Springer Verlag: لندن. ص. 202-224.

Sonnenwald ، D.H. ، K.L. ماجلولين وم. ويتون. استخدام نظرية انتشار الابتكار لتوجيه تقييم تكنولوجيا التعاون: العمل قيد التقدم. في ورشة العمل الدولية العاشرة IEEE حول تمكين التقنيات للشركات التعاونية (WETICE). 2001. نيويورك: مطبعة IEEE.

تايلور الثاني ، آر إم ، تي سي. هدسون ، أ. سيغر ، هـ. ويبر ، ج. جوليانو ، وأ. ت. هيلسر. VRPN: نظام VR محيطي مستقل عن الجهاز وشفاف عن الشبكة. في ندوة ACM حول برامج الواقع الافتراضي وتكنولوجيا الأمبير 2001. 2001. مركز بانف ، كندا.

آرثر ، ك.آثار مجال الرؤية على الأداء مع شاشات مثبتة على الرأس ، في علوم الكمبيوتر 2000 ، جامعة نورث كارولينا: تشابل هيل

بروكس جونيور ، ف. تصميم التصميم. في عنوان جائزة تورينج في SIGGRAPH & # 821700. 2000: اتصالات من ACM.

كريستيانسن ، م ، ك جيفاي ، د. أوت ، وف. حداد. ضبط RED لحركة مرور الويب. في ACM SIGCOMM. 2000. ستوكهولم ، السويد.

Falvo ، M.R. ، J. Steele ، R.M.T. II ، و R. Superfine. حركة Gearlike المتدحرجة بوساطة التلامس المتناسب: الأنابيب النانوية الكربونية على HOPG. فيز. القس ب. 2000. 62(15 أكتوبر): ص. 10665-10667.

Falvo ، M.R. ، J. Steele ، R.M.T. II ، و R. Superfine. دليل على التلامس المتناسب والحركة المتدحرجة: دراسات التلاعب AFM للأنابيب النانوية الكربونية على HOPG. رسائل ترايبولوجي. 2000. 9: ص. 73-76.

Falvo و M.R. و R. Superfine. الميكانيكا والاحتكاك على مقياس نانومتر. مجلة أبحاث الجسيمات النانوية. 2000. 2: ص. 237-248.

جريجوري ، أ. ، م. لين ، س. جوتشالك ، و آر إم تي. ثانيًا. كشف الاصطدام في الوقت الحقيقي للتفاعل اللمسي باستخدام جهاز ردود الفعل 3-DoF. الهندسة الحسابية: النظرية والتطبيقات (إصدار خاص في البيئات الافتراضية). 2000. 15(1-3): ص. 69-89.

جوثولد ، إم ، إم آر فالفو ، دبليو جي ماثيوز ، إس بولسون ، إس واشبورن ، دي إيري ، آر سوبرفاين ، إف بي. بروكس ، و R.M. تايلور. التلاعب المتحكم فيه للعينات الجزيئية باستخدام nanoManipulator. معاملات IEEE / ASME على الميكاترونكس. 2000. 5(2): ص. 189-198.

جوتهولد ، إم ، جيه مولين ، إس لورد ، دي إيري ، آر سوبرفاين ، آر. تايلور. التحكم في التلاعب بجزيئات الفيبرين الفردية. بيوفيز. ج.. 2000. 78: ص. أ 53.

بولسون ، إس. ، إيه هيلسر ، إم بي. نارديلي ، آر إم تي. II ، M. Falvo ، R. Superfine ، و S.Washburn. مقاومة قابلة للضبط لواجهة أنابيب الكربون النانوية والجرافيت. علم. 2000. 290(ديسمبر): ص. 1742-1744.

Rivetti و C. و M. Guthold و C. Bustamante ، غلاف DNA في معقدات محفز مفتوحة E. coli RNA polymerase كشفت عن طريق المسح المجهري للقوة ، في تفاعلات البروتين والحمض النووي: نهج عملي، أ. ترافرز وم. بوكلي ، محرران. 2000 ، مطبعة جامعة أكسفورد: أكسفورد.

Seeger و A. و A. Henderson و GL Pelli و M. Hollins و R.M.T. ثانيًا. عرض لمسي لحقول عددي متعددة على سطح ما. في ورشة عمل حول النماذج الجديدة في تصور المعلومات ومعالجتها. 2000. واشنطن العاصمة: مطبعة إيه سي إم.

Sincell، M. NanoManipulator يتيح للكيميائيين الذهاب إلى Mano a Mano مع الجزيئات. علم. 2000. 290(24 نوفمبر): ص. 1530.

Superfine و R. و G. Jones و R.M. تايلور الثاني. لمس الفيروسات في مشروع التوعية بالفحص المجهري الشبكي. في مؤتمر حول التوعية من رياض الأطفال حتى الصف الثاني عشر من أقسام العلوم بالجامعة. 2000. جامعة ولاية كارولينا الشمالية: دار العلوم.

تايلور الثاني ، ر. أمثلة على التصور العلمي العملي. رسومات الحاسوب. 2000. 34(1): ص. 74-79 وغطاء.

ويجل ، سي ، دبليو جي إميج ، جي ليو ، آر إم. تايلور ، ج. Enns و C.G. هيلي. شرائح نسيج موجهة: تقنية لتقدير القيمة المحلية لحقول عددية متعددة. في واجهة الرسومات. 2000. مونتريال ، كندا.

باستوس ، ر. ، ك. هوف ، دبليو وين ، وأ. لاسترا. زيادة الواقعية للعرض المعماري التفاعلي. في وقائع ندوة 1999 حول الرسومات التفاعلية ثلاثية الأبعاد. 1999.

بروكس جونيور ، ف. ما هو & # 8217s الحقيقي حول الواقع الافتراضي؟ رسومات وتطبيقات الكمبيوتر IEEE. 1999. 19 (6)(نوفمبر / ديسمبر): ص. 16-27.

بوستامانتي ، سي ، إم جوثولد ، إكس.جو ، وجي يانج. تم تسهيل الموقع المستهدف على الحمض النووي بواسطة جزيئات Escherichia coli RNA polymerase الفردية التي لوحظت باستخدام مجهر قوة المسح الذي يعمل في السائل. J بيول كيم. 1999. 274(24): ص. 16665-8. 10358002

كلارك ، م و ك جيفاي. قياسات مستوى التطبيق للأداء على vBNS. في مؤتمر IEEE الدولي لحوسبة الوسائط المتعددة والأنظمة. 1999. فلورنسا ، إيطاليا.

Falvo ، M.R. ، G. Clary ، A. Helser ، S. Paulson ، R.M. تايلور الثاني ، في تشي ، ف. بروكس الابن ، إس واشبورن ، و آر سوبرفاين. تجارب معالجة النانو لاستكشاف الخواص الاحتكاكية والميكانيكية للأنابيب النانوية الكربونية. الفحص المجهري والتحليل الدقيق. 1999. 4: ص. 504-512.

Falvo ، M.R. ، R.M. تايلور ، الثاني ، أ.هيلسر ، في تشي ، ف. بروكس ، الابن ، س. واشبورن ، ور. سوبرفاين. التدحرج على نطاق نانومتر وانزلاق الأنابيب النانوية الكربونية. طبيعة سجية. 1999. 397(6716): ص. 236-8. 9930698

جريجوري ، أ. ، م. لين ، س. جوتشالك ، ور. تايلور. H-COLLIDE: إطار عمل لاكتشاف الاصطدام السريع والدقيق للتفاعل اللمسي. في وقائع VR & # 821799. 1999. هيوستن ، تكساس.

جوثولد ، إم ، إم فالفو ، دبليو جي ماثيوز ، إس بولسون ، جيه مولين ، إس لورد ، دي إيري ، إس واشبورن ، آر سوبرفاين ، إف بي. بروكس الابن و آر إم. تايلور ، الثاني. فحص وتعديل الهياكل الجزيئية باستخدام nanoManipulator. نموذج الرسم البياني J Mol. 1999. 17(3-4): ص. 187-97. 10736776

جوثولد ، إم ، إم آر فالفو ، دبليو جي ماثيوز ، إس. بولسون ، إس واشبورن ، دي إيري ، آر سوبرفاين ، جي إف بي بروكس ، آر إم تي. ثانيًا. التلاعب المتحكم فيه للعينات الجزيئية باستخدام nanoManipulator. 1999.

جوثولد ، إم ، جي ماثيوز ، إيه نيجيشي ، ر. تايلور الثاني ، دي إيري ، ف. بروكس الابن ، و ر. سوبرفاين. التلاعب الكمي للحمض النووي والفيروسات باستخدام مجهر قوة المسح النانوي. تصفح. انترف. التحليلات. 1999. 27: ص. 437-443.

Guthold، M.، X. Zhu، C. Rivetti، G. Yang، NH Thomson، S. Kasas، H.G. Hansma، B. Smith، P.K. هانسما ، وسي. بوستامانتي. المراقبة المباشرة للانتشار والنسخ أحادي البعد بواسطة Escherichia coli RNA polymerase. بيوفيس ج. 1999. 77(4): ص. 2284-94. 10512846

جيفاي ، ك. نحو خدمة إعادة توجيه أفضل من أفضل مجهود لتدفقات الوسائط المتعددة. الوسائط المتعددة IEEE. 1999. 6(4 (أكتوبر- ديسمبر)): ص. 84-88.

جونز ، جي إم ، آر سوبرفاين ، آر إم تي. ثانيًا. الفيروسات الافتراضية. معلم العلوم. 1999. 66(7): ص. 48-50.

ماثيوز ، دبليو جي ، إيه نيجيشي ، إيه سيجر ، آر تايلور ، دي إم. مكارتي ، R.J. Samulski ، و R. Superfine. مرونة وربط الفيروس الغدي في الهواء والسائل. الاجتماع السنوي الثالث والأربعون لجمعية الفيزياء الحيوية ، 13-17 فبراير 1999 ، بالتيمور ، MD Biophys.ج.. 1999. أ 27.

Negishi ، A. ، WG Matthews ، D.M. مكارتي ، R.J. Samulski ، D. Rohrer ، A. Henderson ، R. Taylor ، و R. Superfine. سبر الخصائص الهيكلية للفيروس الغدي باستخدام مجهر القوة الذرية. الاجتماع السنوي الثالث والأربعون لجمعية الفيزياء الحيوية ، 13-17 فبراير 1999 ، بالتيمور ، MD Biophys. ج.. 1999. 76: ص. أ 27.

Paulson، S.، M.R. Falvo، N. Snider، A. Helser، T. Hudson، A. Seeger، R.M. تايلور ، ر. سوبرفاين ، وس. واشبورن. قياسات المقاومة في الموقع لأنابيب الكربون النانوية المتوترة. رسائل الفيزياء التطبيقية. 1999. 75(19): ص. 2936-2938.

Rivetti و C. و M. Guthold و C. Bustamante. التفاف الحمض النووي حول معقد المروج المفتوح E.coli RNA polymerase. إمبو ج. 1999. 18(16): ص. 4464-75. 10449412

Sonnenwald ، D.H. ، E. Kupstas Soo ، و R. Superfine تقييم متعدد الأبعاد لجهاز nanoManipulator ، وهو نظام تعاون علمي. نشرة ACM SIGGROUP. 1999. 20(2): ص. 46-50.

تايلور الثاني ، ر. و R. Superfine ، واجهات متقدمة لمجاهر مسبار ممسوحة ضوئيًا ، بتنسيق كتيب المواد ذات البنية النانوية وتقنية النانو، H. نلوى ، محرر. 1999 مطبعة أكاديمية: نيويورك. ص. 271-308.

تايلور الثاني ، ر. التطبيقات العلمية لملاحظات القوة: المحاكاة الجزيئية والتحكم بالميكروسكوب. في سيجراف & # 821799. 1999. لوس أنجلوس ، كاليفورنيا.

أوسو ، إم ، ك. آرثر ، إم سي. ويتون ، ر. باستوس ، أ. ستيد ، إم سلاتر ، و ف. بروكس. المشي و gt المشي في المكان و gt الطيران في البيئات الافتراضية. في بروك. من SIGGRAPH & # 821799 ، إجراءات رسومات الكمبيوتر ، سلسلة المؤتمرات السنوية. 1999.

آرثر ، ك ، تي بريستون ، ر.تايلور ، ف.ب. الابن ، م. ويتون ، و دبليو. رايت. الحفرة: التصميم والتنفيذ والخطوات التالية. في ورشة العمل الدولية الثانية لتكنولوجيا العرض الغامر. 1998. أميس ، أيوا.

جرانت ، ب ، أ. هيلسر ، و ر. تايلور الثاني. إضافة قوة العرض إلى شاشة عرض مجسمة للرأس مجسمة. في VRAIS & # 821798. 1998. أتلانتا ، جورجيا.

راتكليف ، جي سي ، دي إيه. إيري ، و ر. سوبرفاين. التذبذب الضوئي الحراري للوضع المتذبذب لمجهر القوة الذرية في المحلول. تطبيق فيز. بادئة رسالة.. 1998. 72(15): ص. 1911-1913.

Robinett، W. التبديل بين الأنماط الأربعة لنظام Teleoperator: Teleoperation ، Simulation ، Replay and Robot. في المؤتمر الدولي للواقع الاصطناعي والتواجد عن بعد. 1998. طوكيو ، اليابان.


المواد والأساليب

الأليلات الطافرة

الكشف الكيميائي النسيجي عن نشاط β-galactosidase وتلطيخ الأجسام المضادة

تم إجراء تلطيخ النسيج الكيميائي على الأحشاء المقطوعة يدويًا وفقًا لموراكامي وآخرون. (1994). تم إجراء تلطيخ الأجسام المضادة للأجنة بالطرق القياسية باستخدام مضادات Ultrabithorax والأجسام المضادة للشفاه (Panganiban وآخرون 1990) ، أو العلامة المضادة للفطريات أحادية النسيلة 9E10 (منتجات أبحاث الجينات الورمية) عند 1: 500 ، متبوعة بالتحسين باستخدام Vectastain مجموعة Elite ABC. تم تصوير الأجنة الملطخة والأمعاء المقطوعة إما بمجهر Zeiss Axiophot وتم مسح الصور ضوئيًا باستخدام Nikon Coolscan ، أو تم تصويرها بكاميرا رقمية Spot على مجهر Leica DMR. تم تجميع الصور الرقمية باستخدام Adobe Photoshop 4.0 ، وتم تسميتها بـ FreeHand 8.0 على Power Macintosh.

بناء الجينات المشفرة للجذع / βCYTبروتينات الانصهار

ال UAS - الجذع WT / βCYTتم بناء الجين عن طريق الجمع ، في سلسلة من الخطوات ، شظايا الحمض النووي الخمسة التالية: (1) أ Kpnأنا-سلجزء II (مملوء) من pUAST (Brand and Perrimon 1993) يحتوي على محفز UAS و 36 نيوكليوتيدات من HSP70 5 ′ تسلسل غير مترجم (2) و زهوأنا (ملأت) ل Sspجزء BI من pBD490 (B. Dickson and E. Hafen، pers. comm.) يحتوي على تسلسل إشارة متبوعًا بعلامة myc والنهاية الأمينية للمجال خارج الخلية الجذع (3) و SspBI–سابقة بمعنى البيئةRI (مملوءة) جزء منالجذع WT – sev (Dickson et al.1992) التي تحتوي على باقي المجال خارج الخلية والجذع عبر الغشاء (4) aباممرحبا (قلص مع نوكلياز الفول مونج) إلى Speأنا جزء من pβcyt (انظر أدناه) يحتوي على المجال السيتوبلازمي للإنتجرين βملاحظة الوحدة الفرعية (5) أSpeأنا-روبيةالجزء الثاني الذي يحتوي على موقع polyadenylation من وردية الجين (Martin-Bermudo et al.1997). تم استنساخ الجين بين Kpnانا و روبيةII مواقع في متجه P-element يحتوي على أبيض الجين كعلامة اختيار (pWhiteRabbit ، NH Brown unpubl.). إن البلازميد pβcyt ، الذي يحتوي على أ بامموقع HI عند التقاطع بين المجالات الغشائية والسيتوبلازمية لـ βملاحظة تم إنشاء الوحدة الفرعية بواسطة PCR ، باستخدام التمهيدي GGAGGATCCTCACTACGATCCAC والبادئ في المتجه ، المستنسخة بامأهلا-لاأنا شظية وفحصت بالتسلسل (ملف Speالموقع المستخدم للجزء 4 يقع ضمن المنطقة غير المترجمة 3 منβملاحظة الجين). تسلسل الأحماض الأمينية عند التقاطعات بين المجالات الغشائية والهيولية هي -LLLWKLLTTIHDR- في βملاحظة الوحدة الفرعية و -LTFC RILTTIHDRR- في Torso WT /CYT الانصهار (يتم تسطير تسلسل الجذع وتأتي الأحماض الأمينية الوصلة RI من التركيبي سابقة بمعنى البيئةموقع RI). لتوليدUAS - الجذع D / βCYTالجين ، أ نجوMI-سابقة بمعنى البيئةجزء RI منUAS - الجذع WT / βCYTبالجزء المقابل منالجذع 4021 - سيف (ديكسون وآخرون 1992). تم الحصول على محولات عنصر P بالطرق القياسية ، وتم الحصول على عدة خطوط لكل بناء. تم استخدام الخطوط المستقلة للإنشاءات الخطوط B و E2 و D1 لـ UAS - الجذع WT / βCYTالجين والخطوط B و C للUAS - الجذع D / βcytالجين. تم التعبير عنها في المعى المتوسط ​​بواسطة خط GAL4 48 ص، والتي يتم التعبير عنها في المعى المتوسط ​​من المرحلة 12 فصاعدًا (Martin-Bermudo et al. 1997). لتمييز بشكل لا لبس فيه موا الأجنة المتحولة ، استخدمنا كروموسوم موازن مميز بـ أصفر + (Martin-Bermudo et al. 1997) ، على سبيل المثال ، إناث عذراء y mew M6 / FM6 ، ذ + UAS - الجذع D / βCYT تم عبورهم إلىذ + /ص 24 ب 258 ذكور. في النسل ، كل شيء سوف يعبر UAS - الجذع D / βCYTتحت سيطرة 48Y واحتواء 258 محسن فخ ، و 1/4 التي طافرة ل موا يمكن تمييزها عن طريقذ خطافات الفم.

لتقييم دور الوحدات الفرعية α ، استخدمنا التركيبات UAS التالية: UAS-PS1 2.1 ، UAS-PS1 / 2cyt 2.1 ، UAS-PS2 / 1cyt 2.A ، UAS-PS2 2A (Martin-Bermudo et al. 1997) .


بيولوجيا الورم (10/13)

- حماية الأطراف المفتوحة للكروموسومات من إعادة التركيب ، والاندماج من طرف إلى طرف ، والتعرف على الحمض النووي التالف
-يمكن تكرار الحمض النووي الكامل
- الارتباط مع بعضها البعض لتنظيم النسخ ، وتسهيل اقتران الكروموسومات الشقيقة عند الانقسام ، وربط الكروموسومات بالأغشية النووية

التجديد الذاتي (يمكن أن يشكل خليتين ابنتيتين مع احتفاظ واحدة أو كلتيهما بنفس الخصائص البيولوجية مثل الخلية الأم)

المداومة على الورم على المدى الطويل

هذا يؤدي إلى زيادة امتصاص الجلوكوز (لأنه أقل كفاءة) بسبب التحول في الانزيمات

يتوسع الورم المبكر - ويتجاوز حدود انتشار إمداد الدم المحلي - & gt نقص الأكسجة - وتثبيت gt لـ HIF

الخلايا الشحمية - زيادة هجرة الخلايا السرطانية ، والغزو من خلال تنظيم التعبير وتفعيل MMPs ، والأديبوكينات المؤيدة للالتهابات

ECs - تجنيد الكريات البيض وسلوك الخلايا السرطانية والورم النقيلي ، وتشكيل الأوعية الدموية ، وتعبير MMP و TIMP للتأثير على تطور الورم

Pericytes - استقرار الأوعية الدموية ، ومنع انتشار EC ، والحفاظ على قطر الشعيرات الدموية ، وتنظيم تدفق الدم ، وتوفير إشارات بقاء EC عبر ملامسات نمطية وعوامل قابلة للذوبان

DC - تحفيز الأوعية الدموية ، والتسبب في أمراض المناعة للورم ، والوظائف المؤيدة والمضادة للورم

البلاعم - تنظيم المناعة ونمو الخلايا وتطور الورم

الخلايا المناعية - النمو والتقدم عبر TAMs والخلايا المثبطة المشتقة من النخاع الشوكي والسيتوكينات الخاصة بها (IL-23 و IL-6 و IL-1B و TNF-a)


تفعيل إنتجرين وإعادة الترتيب الهيكلي

يخاطب المؤلفون جونيتشي تاكاجي ، تيموثي إيه سبرينغر ، مركز أبحاث الدم ، أقسام علم الأمراض وطب الأطفال ، كلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس ، الولايات المتحدة الأمريكية.

يخاطب المؤلفون جونيتشي تاكاجي ، تيموثي إيه سبرينغر ، مركز أبحاث الدم ، أقسام علم الأمراض وطب الأطفال ، كلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس ، الولايات المتحدة الأمريكية.

يخاطب المؤلفون جونيتشي تاكاجي ، تيموثي إيه سبرينغر ، مركز أبحاث الدم ، أقسام علم الأمراض وطب الأطفال ، كلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس ، الولايات المتحدة الأمريكية.

يخاطب المؤلفون جونيتشي تاكاجي ، تيموثي إيه سبرينغر ، مركز أبحاث الدم ، أقسام علم الأمراض وطب الأطفال ، كلية الطب بجامعة هارفارد ، بوسطن ، ماساتشوستس ، الولايات المتحدة الأمريكية.

جونيتشي تاكاجي ، تيموثي أ. سبرينغر

الملخص

ملخص: من بين عائلات مستقبلات الالتصاق ، تعتبر الإنتجرينات مهمة بشكل خاص في العمليات البيولوجية التي تتطلب تعديلًا سريعًا للالتصاق وفك الالتصاق. التنشيط على مقياس زمني لـ & lt 1 s من β2 من الإنتغرينات على الكريات البيض و β3 إنتغرينات على الصفائح الدموية يتيح ترسيب هذه الخلايا في مواقع الالتهاب أو إصابة جدار الوعاء الدموي. تؤدي الهياكل البلورية الحديثة والرنين المغناطيسي النووي (NMR) والمجهر الإلكتروني (EM) للإنتجرينات ومجالاتها إلى آلية موحدة للتنشيط لكل من الإنتجرينات التي تحتوي وتلك التي تفتقر إلى المجال المُدرج (I). يتبنى المجال I شكلين بديلين ، يطلق عليهما فتح ومغلق. في تشابه مذهل للإشارة إلى بروتينات G ، ترتبط إعادة ترتيب موقع Mg 2+-ملزم بحركات توافقية كبيرة في مناطق العمود الفقري البعيدة. تُظهر الطفرات التي تثبت تشكلاً معينًا أن التشكل المفتوح له تقارب كبير مع الترابط ، في حين أن التشكل المغلق له تقارب منخفض. إن حركة الطرف C α-helix 10 أسفل جانب المجال في التشكل المفتوح كافية لزيادة التقارب في موقع الربط الترابطي البعيد 9000 ضعف. يوفر هذا "حبل الجرس" C- الطرفية آلية للربط مع الحركات التوافقية في المجالات الأخرى. تكشف الهياكل والدراسات الوظيفية الحديثة عن تفاعلات بين المجالات β-propeller و I و I-like في غطاء الرأس الخاص بإنتجرين ودور حاسم لمجالات عامل نمو البشرة (EGF) في منطقة القصبة. تتجه قطعة الرأس الخاصة بالإنتجرين لأسفل نحو الغشاء في الشكل غير النشط ، وتمتد لأعلى في فتحة تشبه "شفرة التبديل" عند التنشيط. يبدو أن هذه الترتيبات الهيكلية طويلة المدى لجزيء الإنتجرين بأكمله والتي تتضمن جهات اتصال بين المجالات مرتبطة ارتباطًا وثيقًا بالتغييرات التوافقية داخل المجالين I و I-like ، مما يؤدي إلى زيادة التقارب والكفاءة لربط الترابط.


نتائج

فحص MTT

استندت تركيزات EGF وأوقات العلاج على دراسات سابقة مع خطوط خلايا سرطان القولون. على وجه التحديد ، عولجت خلايا HCT116 بـ 1 أو 10 أو 100 نانوغرام / مل من EGF لمدة 5 أو 30 دقيقة أو 1 أو 12 أو 24 أو 48 ساعة ، وتم تقييم الانتشار بواسطة اختبار MTT. كشفت هذه التحليلات أن تكاثر الخلايا HCT116 زاد تدريجيًا بطريقة تعتمد على التركيز والوقت (الشكل 1).

التغييرات في خلايا HCT116 المعالجة بـ EGF. تم تعيين تركيز EGF الأمثل للتجارب المستقبلية عند 100 نانوغرام / مل ، وتم تحديد وقت التعرض الأمثل لعامل النمو في العين عند 24 و 48 ساعة بشكل أساسي (CTL مراقبة)

التعديلات في التعبير 1 و Rab25 بعد التعرض لعامل EGF

تم تعريض خلايا HCT116 لـ 100 نانوغرام / مل من EGF لمدة 24 ساعة ، وتمت مراقبة تعبير إنتجرين β1 و Rab25 عن طريق النشاف الغربي (الشكل 2). والجدير بالذكر أن التعبير 1 للإنتجرين زاد بمرور الوقت استجابةً لتحفيز عامل النمو العكسي ، وبلغ ذروته عند 16 ساعة ثم انخفض بعد ذلك بالنسبة إلى عنصر التحكم β-أكتين (p & lt 0.05 الشكل 2 أ ، ب). تم العثور على نتيجة مماثلة لتعبير Rab25 ، والتي زادت أيضًا استجابةً لعلاج EGF (p & lt 0.05 الشكل. 2 أ ، ج). ومن المثير للاهتمام ، أن التعرض المطول لـ EGF لمدة 48 ساعة أدى إلى انخفاض كبير في تعبير 1 للإنتجرين عند مقارنته بالمستويات القاعدية (p = 0.026 الشكل 3).

تعبير Integrin β1 و Rab25 في الخلايا المعالجة بـ EGF. أ تم فحص تعبير Integrin β1 و Rab25 في خلايا HCT116 التي تم تحفيزها بـ 100 نانوغرام / مل من EGF عن طريق النشاف الغربي. ب, ج قياس كمية البيانات الموضحة في أ ل ب انتجرين β1 و ج Rab25 (CTL مراقبة)

تعبير Integrin β1 بعد تحفيز EGF لمدة 48 ساعة. أ تمت مراقبة تعبير Integrin β1 بعد التحفيز باستخدام 100 نانوغرام / مل من EGF بواسطة النشاف الغربي. ب القياس الكمي للكثافة للبيانات الموضحة في أ (ع = 0.026)

آثار علاج EGF على الاتجار والإفراز للإنتيجرين β1

لتحديد ما إذا كان تحفيز EGF قد غير توطين إنتغرين β1 ، عولجت خلايا HCT116 بـ 100 نانوغرام / مل من EGF ثم خضعت للتجزئة الخلوية وتحليل اللطخة الغربية. أظهرت هذه النتائج أن الإنتجرين β1 كان موضعيًا بشكل حصري تقريبًا لجزء الغشاء ، وانخفض تعبيره تدريجيًا استجابةً لعلاج عامل النمو العشوائي في 24 و 48 ساعة (ع = 0.026 الشكل 4 أ). نظرًا لأنه لم يتم اكتشاف الإنتجرين -1 في الجزء العصاري الخلوي ، فقد أجرينا تحليلات ELISA باستخدام وسائط الثقافة التي تم جمعها بعد 48 ساعة من التعرض لـ 100 نانوغرام / مل من EGF. نتيجة لذلك ، وجدنا زيادة في مستويات إنتغرين -1 من 0.451 نانوغرام / مل في الثقافات غير المعالجة إلى 0.616 نانوغرام / مل بعد 48 ساعة من علاج EGF (الشكل 4 ب). يظهر في الشكل 4 ج التغيرات النسبية في توطين إنتجرين β1 في العصارة الخلوية والغشاء وطاف الثقافة.

تحليل إنتجرين -1 توطين وسفك. أ تم فحص توطين Integrin β1 في الغشاء والعصارة الخلوية عن طريق التجزئة تحت الخلوية والنشاف الغربي. ب تمت مراقبة تساقط Integrin β1 بواسطة ELISA بعد التحفيز باستخدام EGF لمدة 48 ساعة. ج تم فحص التغييرات المعتمدة على EGF في التوطين الخلوي β1 من خلال القياس الكمي للكثافة للبيانات الموضحة في أ

التأثيرات على كل من تعبير Rab25 وتحفيز EGF على تعبير إنتجرين β1 والاتجار به

سعينا بعد ذلك إلى تحديد ما إذا كان تعبير إنتجرين -1 خاضعًا للتنظيم بواسطة Rab25. لهذا ، قمنا بنقل خلايا سرطان القولون HCT116 باستخدام سيرنا الخاص بـ Rab25 وأكدنا ضربة قاضية كافية عن طريق النشاف الغربي (الشكل 5 أ). أظهر التحليل اللاحق لمستويات الإنتجرين -1 انخفاضًا ملحوظًا بعد ضربة قاضية Rab25 (ع = 0.003 الشكل 5 ب). علاوة على ذلك ، أظهر تجزئة الغشاء / العصارة الخلوية أنه على الرغم من أن الإنتجرين -1 كان لا يزال غير قابل للكشف في السيتوبلازم ، حدثت زيادة ملحوظة في جزء الغشاء بعد 24 ساعة من علاج EGF (ع = 0.001) (الشكل 5 ج).

التعديلات في الترجمة إنتجرين 1 بعد ضربة قاضية Rab25. أ تمت مراقبة تعبير Integrin β1 و Rab25 عن طريق النشاف الغربي بعد التجزئة. ب القياس الكمي لقياس الكثافة لتعبير 1 في وهمية وخلايا ضربة قاضية Rab25. ج قياس كمية البيانات الموضحة في أ (CTL مراقبة)

تم إجراء مزيد من تحليل قياس الكثافة لتحديد تأثيرات تحفيز EGF وتعبير Rab25 على توطين Integin β1. والجدير بالذكر أن المستويات المنخفضة من الإنتجرين β1 في العصارة الخلوية قد انخفضت بشكل أكبر استجابةً لتعرض عامل النمو العشوائي (ع = 0.045) ، في حين لوحظ تأثير معاكس في خلايا ضربة قاضية Rab25 المعالجة بـ EGF (ع = 0.011 الشكل 6 أ). بالإضافة إلى ذلك ، أدى تحفيز EGF إلى خفض مستويات الإنتجرين الغشائي β1 في خلايا التحكم (p & lt 0.001) ، ومع ذلك ، تم عكس ذلك في خلايا ضربة قاضية Rab25 ، حيث زادت مستويات الإنتجرين β1 في الغشاء بعد علاج EGF (ع = 0.001) (الشكل 6 ب).

تغييرات تعبير إنتجرين β1 استجابة لتحفيز EGF و Rab25-knockdown. أ, ب التوزيع النسبي للإنتجرين β1 بوصة أ العصارة الخلوية و ب الغشاء بعد تحفيز EGF في السيطرة (CTL التحكم ، الخط الصلب) وخلايا Rab25-knockdown (siRab25 ، الخط المنقط)


استنتاج

استكشف هذا الاستعراض الطبيعة المتعارضة لـ & # x003B22 وظائف الإنتجرين المؤيدة والمضادة للالتهابات في ثلاث وظائف مناعية رئيسية ، مما يجعلها مرشحين رئيسيين ليكونوا وسطاء مهمين ومنظمين للجهاز المناعي. الأول هو الهجرة ، والتي تسمح بالتجنيد المستهدف للخلايا المناعية إلى مواقع العدوى وتلف الأنسجة. والثاني هو الالتصاق ، ليس فقط قبل تسرب الخلايا المناعية في مواقع الالتهاب ، ولكن أيضًا عامل مهم في بدء الاستجابة المناعية التكيفية من خلال تسهيل التفاعلات الخلوية. أخيرًا ، إشارات الخلايا المناعية ، والتي تسمح بالتعاون الدقيق بين مجموعة واسعة من الخلايا المناعية. بالنظر إلى حقيقة أن & # x003B22 تلعب الإنتجرينات دورًا معقدًا في ثلاثة مجالات مهمة من الجهاز المناعي وتعبيرها التفاضلي على الخلايا الأحادية والبلاعم و DCs ، ويتضح أن الدراسات المتنوعة المقدمة في هذه المراجعة ليست شاملة بأي حال من الأحوال. الرسالة المشتركة واضحة: & # x003B22 تشارك الإنتجرينات في مسارات إشارات تنظيم مناعية معقدة. ومع ذلك ، بالإضافة إلى أدوارهم الراسخة المؤيدة للالتهابات في التجنيد والتفعيل ، & # x003B22 كما أن للإنتغرينات وظائف أساسية في تنظيم المناعة. لذلك من المحتمل أن تساهم إشارات الإنتجرين غير المنتظمة والتعبير وتنشيط السطح في مجموعة متنوعة من حالات الالتهاب والمناعة الذاتية. توضيح وظيفة & # x003B22 وبالتالي ، تعد إنتغرينز أيضًا بتقديم أهداف علاجية جديدة للعديد من الاضطرابات ، ويعتبر التهاب المفاصل الروماتويدي مثالًا واحدًا فقط.


4 الاستنتاجات ووجهات النظر

بشكل عام ، تشارك GPCRs في كل جانب من جوانب بيولوجيا الخلايا الجذعية للبشرة ، والحفاظ على هوية الخلايا الجذعية الظهارية البالغة ، وتنسيق تفاعلات الخلايا الجذعية مع مكانها المناسب ودمج الإشارات الخارجية لمساعدة الخلايا الجذعية على التكيف مع التغيرات البيئية. بينما بذلنا جهدًا لربط تأثيرات GPCRs والروابط في تنظيم الخلايا الجذعية ، فمن الواضح أن هناك حاجة إلى نماذج أكثر تحديدًا تكون فيها GPCRs بالضربة القاضية أو يتم التعبير عنها بشكل مفرط في مقصورات خلايا جذعية معينة لتشريح مساهمة المستقبلات في مصير الخلايا الجذعية. من شأن تحليل الخلية المفردة الأكثر حساسية الذي يكتشف الجينات منخفضة التعبير أن يحسن بشكل كبير فهمنا لمجموعة GPCRs المعبر عنها في كل جزء من الخلايا الجذعية للبشرة. هناك حاجة أيضًا إلى مزيد من التقدم في التحقق من صحة نماذج الفئران في بيولوجيا جلد الإنسان نظرًا للاختلافات في بنية الجلد ومعدلات المناعة وجينات GPCR الخاصة بكل نوع.

على الرغم من أننا ركزنا في هذه المراجعة على أدوار GPCRs غير الحسية ، فقد ثبت أن الخلايا الكيراتينية تعبر عن المستقبلات الحسية مثل opsins التي تنشط بالضوء. 112 علاوة على ذلك ، فإن العديد من العناصر الغذائية والمستقلبات الميكروبية تنشط GPCRs ، 113 مما يشير إلى أن عائلة المستقبلات هذه قد تعمل كحلقة وصل بين النظام الغذائي والميكروبيوم والخلايا الجذعية الجسدية.إن الدور الدقيق لـ GPCRs في تحويل أدلة الضوء والغذاء والميكروبيوم لتنسيق مصير الخلايا الجذعية الظهارية هو منطقة مثيرة وغير مكتشفة. جانب رائع آخر من إشارات GPCR هو دورها في تنظيم قمع الورم وتعزيزه. يتم تحور العديد من GPCRs وبروتينات G غير المتجانسة في السرطان وله دور بارز في تعديل المسارات التي تتقاطع مع تقدم الورم ، بما في ذلك إشارات البروستاجلاندين والقنفذ وفرس النهر. ستساعد المزيد من الأبحاث في GPCRs المحددة وشركاء الإشارات والخلايا المعنية في تصميم استراتيجيات علاجية تستهدف مسارات الجذعية الذاتية المرتبطة بالتحول الخبيث ونمو الورم.

أخيرًا ، على الرغم من أن إشارات GPCR عابرة ويتم تنشيط العديد من المسارات بشكل متزامن لإزالة حساسية المستقبلات وإنهاء الشلالات داخل الخلايا ، فإن هذه الإشارات العابرة لها تأثيرات طويلة الأمد في مصير الخلايا الجذعية الظهارية. إن الفهم الأفضل لكيفية تفاعل إشارات GPCR مع التنظيم النسخي والجيني سيوفر رؤى مهمة حول الآليات المشاركة في الحفاظ على هوية الخلايا الجذعية والأساليب التي تستخدمها الخلايا الجذعية للاستجابة والتكيف مع التغيرات البيئية المكروية.


شاهد الفيديو: الصف التاسع مادة الأحياء درس مستويات التنظيم الحياتي وحلول الأسئلة (شهر فبراير 2023).